Entry information : PpaPrx23 (PP00184G00430)
Entry ID 3434
Creation 2008-08-05 (Christophe Dunand)
Last sequence changes 2014-01-07 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: PpaPrx23 (PP00184G00430)
Name (synonym) PpaPrx23 (PP00184G00430)
Class Class III peroxidase    [Orthogroup: Prx107]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx23
start..stop
S start..stop
PpaPrx32 550 0 17..338 14..335
PpaPrx41 283 2e-93 42..337 64..355
PpaPrx15 273 1e-89 40..337 71..365
PpaPrx37 268 6e-88 34..337 24..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 489295..489762 468 N° 2 489887..490052 166 N° 3 490164..490609 446  
join(489295..489762,489887..490052,490164..490609)


exon

Literature and cross-references PpaPrx23 (PP00184G00430)
Literature Kuroki,Y., Toyoda,A., Sakaki,Y., Tanahashi,T., Nishiyama,T., Hiwatashi,Y., Suzuki,Y., Sugano,S., Fujiyama,A. and Hasebe,M. Evolution of developmental genes in land plants. Unpublished (2006)
DNA ref. Phytozome 11:   scaffold_184 (489295..490906)
Cluster/Prediction ref. UniGene:   Ppa.6714 [5' end]   Ppa.13610 [3' end]
Protein sequence: PpaPrx23 (PP00184G00430)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (327)
PWM (Da):   %s   38046.6 (35229.0)  
PI (pH):   %s   5 (4.75) Peptide Signal:   %s   cut: 26 range:26-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARIRFQQTLIVLLSLAAFFRVGDAGCPIASLGRRSLKQAPVPAQPALIFGFYDLTCPTLNSIIDTRMRFWVLQDIRTPGKVLRLFFHDCFAAGCEASILLNSTAEFAAEKDAPISVTLDKFQVIEDIKSEVETACPGIVSCADILALAAAKAVELAGGPILVTETGRRDGVVSYLAGATASMPLSTQKIPDLEAMFVQAGLDINDLVILSGAHTIGEVHCSNFADRFDPAANSPFGDVSFGQELLAFCTRNGAGDIATLNLKTFMDLQTPNSFDISYYVNLIIGRGVMTSDQVLFNDLRTQPMVREFAANRTLFFESFQASMLKMGRLHVLTGTNGVIRKQCGVSVQLEISILRSLRT

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 2 and 3) and 24 ESTs. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGGATAAGGTTTCAGCAAACTTTGATAGTTCTGCTCAGTCTGGCGGCATTTTTCCGGGTAGGAGACGCGGGATGTCCTATCGCTAGCCTAGGAAGGCGGTCATTGAAGCAGGCA
CCTGTGCCAGCGCAACCGGCATTGATATTCGGTTTCTACGACTTAACCTGTCCGACGCTGAATTCTATCATCGACACGAGAATGCGTTTCTGGGTGCTTCAGGATATTCGGACCCCGGGG
AAGGTGCTGAGGCTCTTCTTCCACGACTGTTTTGCGGCTGGGTGCGAGGCTTCAATATTGCTGAATTCCACTGCAGAATTTGCAGCGGAGAAGGACGCACCGATTTCCGTGACTTTAGAC
AAGTTCCAAGTCATCGAGGATATCAAGAGCGAGGTGGAAACGGCGTGCCCTGGAATCGTGTCCTGTGCCGACATTCTGGCACTGGCAGCTGCCAAAGCTGTCGAACTG
GTATTGGCCATA
GCCACTGAGCGTGTAAGGGGTTTCTTGTAACACGTTCGTTTCCGAAGCACGTCATTGGAAGAGTAGAATTGTACAAAATATAGCCTGATTGTCGATCTTGAATGGTTTGCAGGCGGGTGG
ACCGATATTGGTGACGGAAACGGGGCGACGAGATGGCGTGGTTTCGTATCTAGCGGGTGCGACGGCTAGCATGCCTCTATCCACCCAAAAAATTCCTGATCTGGAGGCAATGTTCGTGCA
GGCGGGGCTGGATATAAATGATCTTGTGATTCTCTCAG
GTGGGTCCTGTGCTCCATCCGGTTATCTGGAGTCGAGATTGAATCGATTAATGTGCGAGGGCTGAAGCAGTGGTGATTTCTG
ACATGAAAGTGATGGTGGTGGTGGTTCAGGTGCTCACACTATTGGGGAGGTTCACTGCAGCAACTTCGCTGACCGTTTCGATCCGGCAGCGAACAGCCCCTTCGGCGACGTATCTTTTGG
CCAGGAGCTTCTGGCTTTCTGCACCCGGAACGGCGCGGGCGATATCGCTACGTTGAATCTCAAAACATTCATGGACTTGCAGACGCCCAACAGCTTCGACATCTCGTACTATGTGAACCT
GATCATCGGACGCGGTGTGATGACGTCGGATCAAGTTCTGTTCAACGACCTGCGTACGCAGCCTATGGTGAGGGAGTTCGCGGCCAACCGGACGCTGTTCTTCGAGAGCTTCCAGGCGTC
CATGCTCAAGATGGGGCGGCTCCATGTGCTCACCGGGACGAACGGCGTGATCCGGAAGCAATGCGGGGTAAGTGTGCAGTTAGAGATAAGCATTTTGAGAAGCTTGCGTACATGA

Retrieve as FASTA