Entry information : PpaPrx24 (PP00411G00110)
Entry ID 3435
Creation 2008-08-06 (Christophe Dunand)
Last sequence changes 2010-06-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx24 (PP00411G00110)
Name (synonym) PpaPrx24 (PP00411G00110)
Class Class III peroxidase    [Orthogroup: Prx125]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx24
start..stop
S start..stop
PpaPrx25 532 0 5..338 6..341
PpaPrx11 346 4e-119 28..330 38..341
PpaPrx17 333 5e-114 21..330 30..340
SmPrx16-1_0 311 1e-105 28..330 29..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 135165..135572 408 N° 2 134907..135072 166 N° 3 134320..134792 473  
complement(join(134320..134792,134907..135072,135165..135572))


exon

Literature and cross-references PpaPrx24 (PP00411G00110)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_411 (135572..134320)
Cluster/Prediction ref. UniGene:   Ppa.6585
Protein sequence: PpaPrx24 (PP00411G00110)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (330)
PWM (Da):   %s   37515.51 (35466.5)  
PI (pH):   %s   5.16 (5.01) Peptide Signal:   %s   cut: 26 range:19-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGYRIWQLLFAVWAVSGSGVEVSAQFVGYYRTKDCGIAEAIVTQAVTQAFNQDPSVAPALIRLLFHDCFVEGCDASILLDPSPENPNVEKRSGPNLSVRGYEVIDAAKTQLEKTCPLTVSCADIVALAARDAIVLTGGRHFEMPTGRLDGMVSSTASADANLVSTESSARELTQKFLAQGLGQDEMITLSGAHTIGRTTCAQVTPRLYNFPGSPNGVDPTLDFDYALHLKQVCPQGGNPNSVVQLDPVSPNTFDNMYYTNGVTGRVLFASDIALFADHQTEFASNLNSENAELWQIKFSNALIHMASNKIKFGRPDEEGEIRQNCRLTNARFAATANMSRSAHNHGA

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3) and 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGCTACCGAATATGGCAGCTGCTGTTTGCGGTGTGGGCGGTTTCGGGCAGTGGCGTGGAGGTGAGTGCGCAGTTCGTTGGGTATTACCGCACAAAGGACTGCGGCATTGCAGAA
GCAATTGTCACTCAAGCTGTGACGCAAGCGTTCAACCAGGACCCCAGCGTTGCCCCCGCTCTCATCCGGCTGTTGTTTCATGACTGTTTCGTTGAAGGTTGCGACGCGTCCATTCTCCTT
GATCCTTCTCCCGAGAACCCTAACGTGGAGAAGCGCTCAGGTCCCAACCTATCGGTGCGGGGATACGAGGTGATAGACGCGGCCAAGACGCAGCTCGAAAAAACGTGCCCGTTGACAGTG
TCTTGCGCCGATATTGTGGCGCTTGCCGCCCGCGACGCCATCGTGTTG
GTAAGTGAAACCGTACCAATTAATTATCACCCTTGTGTTCGAAGATTTGTGTTCTGGTCCACAATAGTGATT
GATATTGCGAAATTTGGCAGACTGGCGGACGTCATTTTGAAATGCCGACTGGACGTCTAGATGGTATGGTCTCGAGCACTGCAAGCGCTGACGCGAATCTTGTGTCTACGGAGTCGTCTG
CCAGAGAGCTTACACAGAAGTTTCTGGCACAGGGTCTCGGCCAGGACGAGATGATAACGCTCTCAG
GTATCAATACGGTGATCTAAAGTTATTCCGTTTAGTTTTGATTTCGGAGTGACT
CAAAAACACACGATGATGGTAGTTGAAGTCTAATTCATTCATACGTGATTGTGGATTTAGGTGCACACACAATTGGCAGAACAACGTGTGCGCAAGTTACTCCTCGTCTCTACAACTTTC
CTGGCTCTCCTAACGGTGTTGACCCGACGCTGGACTTCGATTACGCCCTCCATTTGAAACAGGTCTGTCCACAGGGTGGCAACCCCAATTCTGTTGTTCAGCTCGACCCCGTGTCTCCAA
ACACCTTCGACAACATGTACTACACCAATGGCGTCACCGGGCGAGTGCTGTTCGCTTCTGATATTGCTCTCTTCGCTGACCACCAGACGGAGTTTGCGTCCAACTTGAACTCTGAGAATG
CGGAACTGTGGCAGATCAAGTTTTCGAATGCGTTAATACACATGGCGTCCAACAAGATCAAGTTCGGAAGGCCGGATGAAGAGGGCGAAATTCGTCAAAATTGCCGGTTAACAAACGCTA
GGTTTGCGGCCACGGCCAACATGTCAAGATCCGCGCATAATCATGGAGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGCTACCGAATATGGCAGCTGCTGTTTGCGGTGTGGGCGGTTTCGGGCAGTGGCGTGGAGGTGAGTGCGCAGTTCGTTGGGTATTACCGCACAAAGGACTGCGGCATTGCAGAA
GCAATTGTCACTCAAGCTGTGACGCAAGCGTTCAACCAGGACCCCAGCGTTGCCCCCGCTCTCATCCGGCTGTTGTTTCATGACTGTTTCGTTGAAGGTTGCGACGCGTCCATTCTCCTT
GATCCTTCTCCCGAGAACCCTAACGTGGAGAAGCGCTCAGGTCCCAACCTATCGGTGCGGGGATACGAGGTGATAGACGCGGCCAAGACGCAGCTCGAAAAAACGTGCCCGTTGACAGTG
TCTTGCGCCGATATTGTGGCGCTTGCCGCCCGCGACGCCATCGTGTTG
ACTGGCGGACGTCATTTTGAAATGCCGACTGGACGTCTAGATGGTATGGTCTCGAGCACTGCAAGCGCTGAC
GCGAATCTTGTGTCTACGGAGTCGTCTGCCAGAGAGCTTACACAGAAGTTTCTGGCACAGGGTCTCGGCCAGGACGAGATGATAACGCTCTCAG
GTGCACACACAATTGGCAGAACAACG
TGTGCGCAAGTTACTCCTCGTCTCTACAACTTTCCTGGCTCTCCTAACGGTGTTGACCCGACGCTGGACTTCGATTACGCCCTCCATTTGAAACAGGTCTGTCCACAGGGTGGCAACCCC
AATTCTGTTGTTCAGCTCGACCCCGTGTCTCCAAACACCTTCGACAACATGTACTACACCAATGGCGTCACCGGGCGAGTGCTGTTCGCTTCTGATATTGCTCTCTTCGCTGACCACCAG
ACGGAGTTTGCGTCCAACTTGAACTCTGAGAATGCGGAACTGTGGCAGATCAAGTTTTCGAATGCGTTAATACACATGGCGTCCAACAAGATCAAGTTCGGAAGGCCGGATGAAGAGGGC
GAAATTCGTCAAAATTGCCGGTTAACAAACGCTAGGTTTGCGGCCACGGCCAACATGTCAAGATCCGCGCATAATCATGGAGCTTGA

Retrieve as FASTA