Entry information : PpaPrx25 (PP00160G00750)
Entry ID 3436
Creation 2008-08-06 (Christophe Dunand)
Last sequence changes 2010-06-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: PpaPrx25 (PP00160G00750)
Name (synonym) PpaPrx25 (PP00160G00750)
Class Class III peroxidase    [Orthogroup: Prx125]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx25
start..stop
S start..stop
PpaPrx24 532 0 6..341 5..338
PpaPrx11 335 1e-114 2..333 13..341
PpaPrx17 320 4e-109 18..333 28..340
SmPrx16-1_0 310 3e-105 27..333 25..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 929301..929717 417 N° 2 929040..929205 166 N° 3 928549..928862 314 N° 4 928295..928426 132
complement(join(928295..928426,928549..928862,929040..929205,929301..929717))


exon

Literature and cross-references PpaPrx25 (PP00160G00750)
Literature Nishiyama,T., Fujita,T., Sakakibara,K., Shin-i,T., Kohara,Y. and Hasebe,M. Physcomitrella patens EST from young sporophytes with surrounding archegonia. Unpublished (2005).
DNA ref. Phytozome 12:   scaffold_160 (929717..928295)
Cluster/Prediction ref. UniGene:   Ppa.8800
Protein sequence: PpaPrx25 (PP00160G00750)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (315)
PWM (Da):   %s   36981.09 (34106.6)  
PI (pH):   %s   5.33 (5.08) Peptide Signal:   %s   cut: 28 range:28-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISCRVWRLLLALCTLGSVGMESVNAQFFNNFYTTKGCDSAEAIVTQAVTEAFNQDPSVAPALIRMLFHDCFVEGCDGSLLLDPTPQNPNVEKLALPNLSVRGYEVIDAAKMQLEKTCPRTVSCADIVALAARDAVLLTGGQHFDMPTGRLDGMVSTADNANNNLVSTRSSATELTRKFLEQGLGQDDMITLSGAHTVGKTTCGQITSRLYNFPGTTNGVDPTLDFDYALHLQQLCPQNGNPNDPVPLDPVSPNTFDNMYYTNGVTGRVLFPSDNVLFADHQTQFASNLNSQNGQFWMKFANALVRMASNKVKLGVPNRNGEIRKNCRFTNAATGSSTNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3) and 11 ESTs. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTAGCTGCAGAGTATGGCGACTCCTGCTGGCATTATGCACCCTAGGATCAGTTGGCATGGAGTCAGTAAATGCGCAGTTCTTCAACAATTTCTACACGACCAAGGGGTGCGAC
TCAGCAGAGGCCATCGTCACTCAAGCTGTCACGGAAGCGTTCAATCAAGACCCCAGCGTCGCTCCCGCCCTCATCAGAATGCTGTTCCATGACTGCTTTGTGGAGGGTTGTGATGGTTCC
CTTCTCCTGGACCCCACCCCCCAGAATCCAAATGTGGAGAAACTGGCGTTACCGAATCTCTCCGTAAGAGGATATGAAGTGATTGATGCCGCCAAGATGCAGCTCGAGAAGACGTGTCCC
AGAACCGTATCCTGTGCCGACATTGTGGCGCTTGCGGCACGCGACGCAGTGCTGTTG
GTAAGAGCTGACGCGACTCATTCCTGCTAATGACGATGCACAAAACCCCTTTAATTAATCATG
TGAATTTCAAACTAACTGGTGAGCAAATGCAGACTGGTGGACAGCACTTCGATATGCCCACGGGCCGTCTGGATGGAATGGTTTCAACTGCCGACAACGCCAACAACAATTTAGTGTCAA
CCCGATCCTCTGCAACGGAGCTCACCCGAAAATTCTTGGAACAGGGTCTCGGCCAGGATGATATGATAACGCTATCTG
GTAAACAGCCGTGACTGTGACTTGGAAACTGCTCCAGATTCC
ACTCATTTCACTACAGTGTAGGATTTTCATTGTTATTCGTGATTATGATTACCATTGTTGTTATTGTTCACCAGGTAAACGTATTGTGAGAAGCTGAGAGAAAGGGAAATCAGTAAACTT
TGCACATTTTTGCAGGAGCCCACACTGTTGGAAAAACGACATGCGGCCAAATCACGTCTCGTCTGTACAACTTCCCTGGCACTACCAACGGCGTGGACCCCACTCTGGACTTCGACTATG
CCCTGCATTTGCAACAACTGTGTCCTCAGAATGGTAATCCGAACGACCCAGTCCCACTAGACCCAGTCTCTCCCAACACCTTCGATAACATGTACTACACCAATGGCGTCACGGGACGCG
TTCTTTTTCCATCCGACAACGTTCTGTTCGCCGACCACCAAACGCAATTCGCATCCAACTTGAATTCACAGAACGGGCAATTCTGGCAG
GTAAGTGAGAATCACAACCTCCACCTAGTCT
AAGCTGTGCCAGTCTCTACCTATGCTTTCCCTTCGTGTGCAAATTTGTTGATAGGAAAGACCCTGAACAGCATCGAGGTGTGCTTCCACAGATGAAATTCGCGAATGCACTGGTGCGCAT
GGCTTCGAACAAGGTAAAGCTGGGCGTTCCCAACCGAAATGGTGAAATACGAAAGAATTGCCGATTCACGAATGCTGCTACTGGGTCTAGTACAAACAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATTAGCTGCAGAGTATGGCGACTCCTGCTGGCATTATGCACCCTAGGATCAGTTGGCATGGAGTCAGTAAATGCGCAGTTCTTCAACAATTTCTACACGACCAAGGGGTGCGAC
TCAGCAGAGGCCATCGTCACTCAAGCTGTCACGGAAGCGTTCAATCAAGACCCCAGCGTCGCTCCCGCCCTCATCAGAATGCTGTTCCATGACTGCTTTGTGGAGGGTTGTGATGGTTCC
CTTCTCCTGGACCCCACCCCCCAGAATCCAAATGTGGAGAAACTGGCGTTACCGAATCTCTCCGTAAGAGGATATGAAGTGATTGATGCCGCCAAGATGCAGCTCGAGAAGACGTGTCCC
AGAACCGTATCCTGTGCCGACATTGTGGCGCTTGCGGCACGCGACGCAGTGCTGTTG
ACTGGTGGACAGCACTTCGATATGCCCACGGGCCGTCTGGATGGAATGGTTTCAACTGCCGAC
AACGCCAACAACAATTTAGTGTCAACCCGATCCTCTGCAACGGAGCTCACCCGAAAATTCTTGGAACAGGGTCTCGGCCAGGATGATATGATAACGCTATCTG
GAGCCCACACTGTTGGA
AAAACGACATGCGGCCAAATCACGTCTCGTCTGTACAACTTCCCTGGCACTACCAACGGCGTGGACCCCACTCTGGACTTCGACTATGCCCTGCATTTGCAACAACTGTGTCCTCAGAAT
GGTAATCCGAACGACCCAGTCCCACTAGACCCAGTCTCTCCCAACACCTTCGATAACATGTACTACACCAATGGCGTCACGGGACGCGTTCTTTTTCCATCCGACAACGTTCTGTTCGCC
GACCACCAAACGCAATTCGCATCCAACTTGAATTCACAGAACGGGCAATTCTGGCAG
ATGAAATTCGCGAATGCACTGGTGCGCATGGCTTCGAACAAGGTAAAGCTGGGCGTTCCCAAC
CGAAATGGTGAAATACGAAAGAATTGCCGATTCACGAATGCTGCTACTGGGTCTAGTACAAACAATTGA

Retrieve as FASTA