Entry information : PpaPrx29 (PP00001G03290)
Entry ID 3440
Creation 2009-08-17 (Christophe Dunand)
Last sequence changes 2009-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: PpaPrx29 (PP00001G03290)
Name (synonym) PpaPrx29 (PP00001G03290)
Class Class III peroxidase    [Orthogroup: Prx051]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx29
start..stop
S start..stop
PpaPrx51 512 0 1..323 1..321
PpaPrx55 508 0 1..323 1..321
PpaPrx31 462 2e-165 1..321 1..325
PpaPrx14 350 6e-121 18..321 30..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3624207..3624437 231 N° 2 3623853..3624032 180 N° 3 3623119..3623679 561  
complement(join(3623119..3623679,3623853..3624032,3624207..3624437))


exon

Literature and cross-references PpaPrx29 (PP00001G03290)
Literature REFERENCE 1 Kuroki,Y., Toyoda,A., Sakaki,Y., Tanahashi,T., Nishiyama,T., Hiwatashi,Y., Suzuki,Y., Sugano,S., Fujiyama,A. and Hasebe,M. Evolution of developmental genes in land plants. Unpublished (2006).
REFERENCE 2 Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008).
DNA ref. Phytozome 12:   scaffold_1 (3624437..3623119)
EST ref. GenBank:   BY984670 [5' end]
Protein sequence: PpaPrx29 (PP00001G03290)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (295)
PWM (Da):   %s   34699.57 (31826.0)  
PI (pH):   %s   9.38 (8.99) Peptide Signal:   %s   cut: 29 range:29-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKWSSKALATIFVTLAIAMNSITPAVAHSGLKVGFYHHSCPEVETIVYNSMVQSYKANHTVAPGVLRMAFHDCFVRGCDASVLLEGPNTERTALFNRGLHGFEAVDAAKRAVESACPGIVSAADILQFAARDSVVLAGGYGWRVPAGRRDGKVSLAEEATQMNLPAPNATVSQLIRMFGAKGLSASEMVVLSGAHTIGRAPCVTFDDRVQTSPVDPTLAPNFAASLKRQCPYPGIGSTSVNMDSTTRRFDSQYYKDIIRGRGLLTSDQGLLYDSRTKRDVHANKGSAFYRNFAQAMVAMSRIEVLTGRSGEIRRQVGEVNKY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and 1 EST. Incorrect prediction from Phytozome (shorter PS). Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTGGTCCTCGAAAGCCTTAGCGACGATCTTCGTTACCCTCGCCATTGCCATGAACTCAATCACCCCGGCAGTCGCTCACAGCGGGCTGAAGGTAGGGTTCTATCATCACAGC
TGTCCGGAAGTCGAGACCATTGTCTACAATTCTATGGTTCAATCCTACAAGGCGAACCACACCGTTGCACCTGGAGTTCTCCGGATGGCGTTCCACGACTGCTTCGTGCGG
GTAAGTGAT
CGCTTTGACTTGCAGCGCCCCAGCCGGCTAGAACGATTCGCAGAGCTTGTGGTAGGACGTACCTGGATCGCGAGTTTGGTTTGCCTGAGTTACCTTCCTCAAATGCTTCGCACTGTGACC
AAATCGCCTCCTGACGTGAATCTTTGGTCTGCTTGGCTTCTTCAGGGTTGCGACGCTTCCGTTCTACTGGAAGGACCCAACACAGAGCGAACGGCTCTATTCAACCGGGGGCTCCATGGC
TTTGAGGCGGTGGACGCCGCCAAGAGAGCTGTGGAGAGCGCTTGCCCAGGCATCGTCTCAGCCGCCGACATATTGCAGTTTGCCGCCCGCGACTCAGTTGTGCTG
GTAAGCTACAGTCCT
AAACTGCGAAGGTGGTAGTATCTGCGGATCAAGGTTGATGTTGGTTCCCGCCTTGACCCGATCCCACACCAGATGGATGATTCGGAAGCGCATCGCATTCCACGCTGCACAGGTTGATTG
TCAGGATCTCGTTTCTGACCTGTGGATTGCTTGTCCAGGCTGGAGGTTACGGATGGCGTGTGCCTGCTGGCCGTCGAGACGGAAAGGTTTCCCTCGCGGAGGAGGCGACGCAAATGAACC
TGCCCGCCCCGAACGCGACCGTGTCTCAACTCATACGTATGTTCGGGGCGAAGGGTTTGAGCGCCTCCGAAATGGTAGTCCTGTCAGGCGCCCACACGATCGGCAGAGCTCCGTGCGTTA
CGTTTGATGACCGCGTTCAGACAAGCCCGGTCGACCCAACTCTGGCTCCCAACTTCGCCGCGTCCTTGAAGAGGCAGTGCCCGTATCCAGGAATCGGATCCACTAGCGTGAACATGGATT
CCACCACACGGAGGTTCGACAGCCAGTACTACAAGGACATCATCCGAGGGAGAGGCCTGCTGACCTCGGACCAGGGCCTACTGTACGACTCGCGTACCAAGCGGGATGTGCACGCCAACA
AGGGTTCTGCATTCTACCGAAACTTTGCCCAGGCGATGGTGGCGATGAGCCGGATTGAGGTGTTGACAGGTCGTTCCGGCGAAATTCGCCGACAGGTTGGAGAGGTGAACAAGTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTGGTCCTCGAAAGCCTTAGCGACGATCTTCGTTACCCTCGCCATTGCCATGAACTCAATCACCCCGGCAGTCGCTCACAGCGGGCTGAAGGTAGGGTTCTATCATCACAGC
TGTCCGGAAGTCGAGACCATTGTCTACAATTCTATGGTTCAATCCTACAAGGCGAACCACACCGTTGCACCTGGAGTTCTCCGGATGGCGTTCCACGACTGCTTCGTGCGG
GGTTGCGAC
GCTTCCGTTCTACTGGAAGGACCCAACACAGAGCGAACGGCTCTATTCAACCGGGGGCTCCATGGCTTTGAGGCGGTGGACGCCGCCAAGAGAGCTGTGGAGAGCGCTTGCCCAGGCATC
GTCTCAGCCGCCGACATATTGCAGTTTGCCGCCCGCGACTCAGTTGTGCTG
GCTGGAGGTTACGGATGGCGTGTGCCTGCTGGCCGTCGAGACGGAAAGGTTTCCCTCGCGGAGGAGGCG
ACGCAAATGAACCTGCCCGCCCCGAACGCGACCGTGTCTCAACTCATACGTATGTTCGGGGCGAAGGGTTTGAGCGCCTCCGAAATGGTAGTCCTGTCAGGCGCCCACACGATCGGCAGA
GCTCCGTGCGTTACGTTTGATGACCGCGTTCAGACAAGCCCGGTCGACCCAACTCTGGCTCCCAACTTCGCCGCGTCCTTGAAGAGGCAGTGCCCGTATCCAGGAATCGGATCCACTAGC
GTGAACATGGATTCCACCACACGGAGGTTCGACAGCCAGTACTACAAGGACATCATCCGAGGGAGAGGCCTGCTGACCTCGGACCAGGGCCTACTGTACGACTCGCGTACCAAGCGGGAT
GTGCACGCCAACAAGGGTTCTGCATTCTACCGAAACTTTGCCCAGGCGATGGTGGCGATGAGCCGGATTGAGGTGTTGACAGGTCGTTCCGGCGAAATTCGCCGACAGGTTGGAGAGGTG
AACAAGTACTAG

Retrieve as FASTA