Entry information : PnoCP01
Entry ID 3449
Creation 2006-08-11 (Marcel Zamocky)
Last sequence changes 2012-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PnoCP01
Name PnoCP01
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCP01
start..stop
S start..stop
Ssrc1lsm3aCP01 1415 0 1..762 1..761
PterCP 1318 0 1..762 1..760
PtritCP01 1317 0 1..762 1..760
AalteCP01 1316 0 1..762 1..760
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 288092..288351 260 N° 2 287565..288037 473 N° 3 285957..287512 1556  
complement(join(285957..287512,287565..288037,288092..288351))


exon

Literature and cross-references PnoCP01
Literature Birren,B., et al. CONSRTM The Broad Institute Genome Sequencing Platform. Annotation of the Phaeosphaeria nodorum SN15 genome.(Unpublished)
Protein ref. UniProtKB:   Q0U324
DNA ref. JGI genome:   scaffold_28 (288351..285957)
Protein sequence: PnoCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   762
PWM (Da):   %s   84459.07  
PI (pH):   %s   6.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKGECPMRTANVAGGGTKIKDWWPNELPVSVLRQHDPRQNPLTSDFNYAEEFKKLDYNALKKDLTALMTDSQDWWPADFGHYGGLFVRMAWHSAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMGCETFGFAGGRPDTFQSDESIYWGGEDTWLGNDVRYSNGNKGVSGEGVVDGDQHKMDHKDIHSRDLEQPVAAAHMGLIYVNPGPDGVPDPIAAARDIRTTFHRMAMNDEETAALIIGGHSFGKTHGAAPSENTGPDPNSEDLSTQGFGWINKHGSGKGPDTITSGLEVTWTGTPTKWSNKYLEYLYKYEWELEKSPAGANQWVAKTEDHIIPDAYDANKKHKPRMLTTDMSMRMDPGFEKITRRWLDHPQELHDAFIRAWFKLLHRDMGPRSRWVGPEIPKEVLLWEDPVPEVDHALVEESDISALKKQILEAGIEPSKLIRTAWASAASYRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGVQSKFNGSASGGKKISLADLIVLAGTAAVEKAAGVSVPFTPGRTDATEEQTDAKSFEHLEPATDPFRNYGKSSDRARTEQLDLDKASLLRLTAPELTVLVGGMRALNANWDSSSHGIFTKRPGQLTNDFFVNLLDINTEWKAADSSKLPELYEGFDRKSGQKKWTGTRHDLVYGSHPELRAIAEVYAQPDNSDKFVKDFVKAWDKVMSNDRFDLKAKSVSGSSSVSRPRL

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Strain="SN15", Uniprot entry difference on C-terminus
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGCCCCATGAGAACCGCCAATGTCGCAGGTGGCGGCACCAAGATCAAAGACTGGTGGCCAAATGAGCTTCCGGTCAGCGTTCTTCGCCAGCACGACCCACGCCAG
AACCCTTTGACCTCCGACTTCAACTACGCCGAGGAATTCAAGAAGCTTGACTACAATGCATTGAAGAAGGACCTCACTGCCTTGATGACCGATTCCCAGGACTGGTGGCCTGCGGACTTT
GGCCACTATGGTGGTCTCTT
GTAAGTTACCACTGCTTGCTTTACACATCATAATTGTGCTAACTGGGACGACAGTGTCCGAATGGCATGGCATTCTGCCGGAACCTACCGCGTCACTGAC
GGTCGTGGTGGAGGTGGTGATGGCCAGCAGCGTTTCGCTCCTCTGAACGCGTGGCCTGACAACGTCTCCCTCGATAAGGCTCGTCGTCTCCTCTGGCCCATCAAGCAGAAGTACGGCAAC
AAGATCTCATGGGCGGATCTTATGCTCTTGACTGGCAACGTCGCCCTTGAGTCCATGGGCTGCGAGACTTTCGGTTTCGCCGGTGGACGTCCAGACACATTCCAGTCCGACGAGTCAATT
TACTGGGGAGGAGAAGACACATGGCTGGGCAATGATGTCCGCTACTCCAACGGAAACAAGGGTGTCTCAGGCGAGGGTGTTGTCGACGGTGACCAGCACAAGATGGACCACAAGGACATC
CATTCGCGTGACCTCGAGCAGCCTGTTGCGGCCGCACACATGGGACTCATCTATGTTAACCCCGAGG
GTAAGTAACCATCACTTCAGACTCGATTGAGCCTATCCACTGACTTGACTAGG
TCCCGACGGTGTCCCCGACCCAATTGCCGCTGCCCGAGACATCCGTACAACCTTCCACCGTATGGCCATGAACGACGAGGAGACTGCTGCTCTTATCATCGGTGGCCACTCCTTCGGAAA
GACTCACGGAGCCGCTCCCTCGGAGAACACCGGCCCTGACCCCAACAGCGAGGACCTGTCTACTCAGGGCTTCGGCTGGATCAACAAGCACGGCAGTGGCAAGGGCCCTGACACCATCAC
CAGTGGTCTCGAGGTCACATGGACAGGCACACCAACCAAGTGGAGCAACAAGTACCTTGAGTATCTCTACAAATATGAGTGGGAGCTGGAGAAGAGTCCTGCTGGTGCGAACCAGTGGGT
TGCTAAGACTGAAGACCACATCATTCCGGACGCCTATGATGCGAACAAGAAGCACAAGCCCAGGATGTTGACCACCGATATGTCAATGCGCATGGATCCTGGCTTCGAGAAGATCACCCG
CCGTTGGCTCGACCACCCACAAGAACTCCACGATGCCTTCATTCGCGCGTGGTTCAAGCTTCTCCACCGTGACATGGGTCCTCGATCCAGATGGGTCGGCCCTGAGATTCCCAAGGAGGT
CTTGCTCTGGGAAGACCCAGTCCCCGAGGTTGACCACGCCCTTGTCGAGGAGTCGGACATCTCTGCCCTTAAGAAGCAGATTCTCGAGGCCGGCATCGAGCCATCCAAGCTCATCCGCAC
TGCATGGGCTTCGGCAGCGTCCTACCGCGGCAGCGACAAGCGTGGTGGTGCCAACGGTGCCCGCATCCGCCTGGCACCGCAAAAGGACTGGGAGGTCAACAACCCTAAGGAGCTCGCTGA
GGTACTCAAGGCTCTCGAGGGCGTTCAGTCCAAGTTCAACGGCTCTGCGTCTGGCGGCAAGAAGATCTCTCTTGCTGACCTGATCGTCCTCGCCGGAACTGCCGCTGTCGAGAAGGCTGC
CGGTGTCTCGGTTCCCTTCACACCCGGCCGCACCGACGCCACTGAGGAGCAGACCGACGCCAAGTCGTTTGAGCACCTTGAGCCTGCCACTGACCCCTTCCGCAACTACGGAAAGAGCTC
AGACCGTGCCCGCACTGAGCAGCTTGACCTCGACAAGGCTTCTCTCCTCCGCCTCACTGCTCCCGAGCTTACCGTCCTTGTTGGCGGTATGCGTGCGCTAAATGCCAACTGGGACAGCTC
ATCCCACGGTATCTTCACCAAGCGCCCTGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTCGATATCAACACAGAGTGGAAGGCGGCCGACTCGTCCAAGCTGCCCGAGCTTTATGA
GGGCTTCGACCGCAAGTCTGGCCAGAAGAAGTGGACTGGTACACGCCACGACCTCGTTTACGGCTCGCACCCCGAGCTTCGGGCTATCGCTGAGGTATACGCCCAGCCCGACAACTCAGA
CAAGTTTGTCAAGGACTTTGTGAAGGCTTGGGATAAGGTCATGTCTAACGACCGCTTCGACCTTAAGGCCAAATCGGTGAGTGGCTCATCGAGTGTTTCCAGGCCTCGTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGCCCCATGAGAACCGCCAATGTCGCAGGTGGCGGCACCAAGATCAAAGACTGGTGGCCAAATGAGCTTCCGGTCAGCGTTCTTCGCCAGCACGACCCACGCCAG
AACCCTTTGACCTCCGACTTCAACTACGCCGAGGAATTCAAGAAGCTTGACTACAATGCATTGAAGAAGGACCTCACTGCCTTGATGACCGATTCCCAGGACTGGTGGCCTGCGGACTTT
GGCCACTATGGTGGTCTCTT
TGTCCGAATGGCATGGCATTCTGCCGGAACCTACCGCGTCACTGACGGTCGTGGTGGAGGTGGTGATGGCCAGCAGCGTTTCGCTCCTCTGAACGCGTGG
CCTGACAACGTCTCCCTCGATAAGGCTCGTCGTCTCCTCTGGCCCATCAAGCAGAAGTACGGCAACAAGATCTCATGGGCGGATCTTATGCTCTTGACTGGCAACGTCGCCCTTGAGTCC
ATGGGCTGCGAGACTTTCGGTTTCGCCGGTGGACGTCCAGACACATTCCAGTCCGACGAGTCAATTTACTGGGGAGGAGAAGACACATGGCTGGGCAATGATGTCCGCTACTCCAACGGA
AACAAGGGTGTCTCAGGCGAGGGTGTTGTCGACGGTGACCAGCACAAGATGGACCACAAGGACATCCATTCGCGTGACCTCGAGCAGCCTGTTGCGGCCGCACACATGGGACTCATCTAT
GTTAACCCCGAGG
GTCCCGACGGTGTCCCCGACCCAATTGCCGCTGCCCGAGACATCCGTACAACCTTCCACCGTATGGCCATGAACGACGAGGAGACTGCTGCTCTTATCATCGGTGGC
CACTCCTTCGGAAAGACTCACGGAGCCGCTCCCTCGGAGAACACCGGCCCTGACCCCAACAGCGAGGACCTGTCTACTCAGGGCTTCGGCTGGATCAACAAGCACGGCAGTGGCAAGGGC
CCTGACACCATCACCAGTGGTCTCGAGGTCACATGGACAGGCACACCAACCAAGTGGAGCAACAAGTACCTTGAGTATCTCTACAAATATGAGTGGGAGCTGGAGAAGAGTCCTGCTGGT
GCGAACCAGTGGGTTGCTAAGACTGAAGACCACATCATTCCGGACGCCTATGATGCGAACAAGAAGCACAAGCCCAGGATGTTGACCACCGATATGTCAATGCGCATGGATCCTGGCTTC
GAGAAGATCACCCGCCGTTGGCTCGACCACCCACAAGAACTCCACGATGCCTTCATTCGCGCGTGGTTCAAGCTTCTCCACCGTGACATGGGTCCTCGATCCAGATGGGTCGGCCCTGAG
ATTCCCAAGGAGGTCTTGCTCTGGGAAGACCCAGTCCCCGAGGTTGACCACGCCCTTGTCGAGGAGTCGGACATCTCTGCCCTTAAGAAGCAGATTCTCGAGGCCGGCATCGAGCCATCC
AAGCTCATCCGCACTGCATGGGCTTCGGCAGCGTCCTACCGCGGCAGCGACAAGCGTGGTGGTGCCAACGGTGCCCGCATCCGCCTGGCACCGCAAAAGGACTGGGAGGTCAACAACCCT
AAGGAGCTCGCTGAGGTACTCAAGGCTCTCGAGGGCGTTCAGTCCAAGTTCAACGGCTCTGCGTCTGGCGGCAAGAAGATCTCTCTTGCTGACCTGATCGTCCTCGCCGGAACTGCCGCT
GTCGAGAAGGCTGCCGGTGTCTCGGTTCCCTTCACACCCGGCCGCACCGACGCCACTGAGGAGCAGACCGACGCCAAGTCGTTTGAGCACCTTGAGCCTGCCACTGACCCCTTCCGCAAC
TACGGAAAGAGCTCAGACCGTGCCCGCACTGAGCAGCTTGACCTCGACAAGGCTTCTCTCCTCCGCCTCACTGCTCCCGAGCTTACCGTCCTTGTTGGCGGTATGCGTGCGCTAAATGCC
AACTGGGACAGCTCATCCCACGGTATCTTCACCAAGCGCCCTGGCCAGCTCACCAACGACTTCTTCGTCAACCTGCTCGATATCAACACAGAGTGGAAGGCGGCCGACTCGTCCAAGCTG
CCCGAGCTTTATGAGGGCTTCGACCGCAAGTCTGGCCAGAAGAAGTGGACTGGTACACGCCACGACCTCGTTTACGGCTCGCACCCCGAGCTTCGGGCTATCGCTGAGGTATACGCCCAG
CCCGACAACTCAGACAAGTTTGTCAAGGACTTTGTGAAGGCTTGGGATAAGGTCATGTCTAACGACCGCTTCGACCTTAAGGCCAAATCGGTGAGTGGCTCATCGAGTGTTTCCAGGCCT
CGTCTTTGA

Retrieve as FASTA