Entry information : MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Entry ID 345
Creation 2005-09-13 (Christophe Dunand)
Last sequence changes 2011-07-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-07-29 (Christophe Dunand)
Peroxidase information: MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Name (synonym) MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Root tips
Inducers Nitrogen starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx18
start..stop
S start..stop
GmPrx[P]269 547 0 11..335 7..328
GmPrx167 544 0 19..335 18..340
PpePrx49 471 9e-169 40..333 41..335
CsaPrx34 459 9e-164 35..333 38..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55970927..55971184 258 N° 2 55971368..55972117 750  
join(55970927..55971184,55971368..55972117)


exon

Literature and cross-references MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Literature Journet,E.P. et al., unpublished, VandenBosch,K. et al., unpublished.
DNA ref. Phytozome 11:   chr4 (55970927..55972117)
Cluster/Prediction ref. Phytozome Gene 11:   31114037
Omic ref. Gene atlas:   Mtr.38220.1.S1_at Legoo:   Mtr.38220.1.S1_at
Protein sequence: MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 336 (312)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
37531.67 (34738.1) Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i5-24o
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.34 (9.23) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 24 range:24-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFHYLSLFLLVIILELSTNVYGLMPKRSLKPLLPPPEALLSIGHYHSTCPDAEGIISQKVFAWVKKDPTLAPSIIRLHFHDCAVRGCDGSILLNHVGSERTAFASKTLRGFQLIDEIKAELERRCPRTVSCADILTAATRDATILAGGPFWEVPFGRKDGKISIAKEANLVPQGHENITGLIGFFQERGLDMLDLVTLSGSHTIGRSTCYSVMNRIYNFNGTGKPDPSLNIYYLKMLRKRCKKDLDLVHLDVITPRTFDTTYYTNLKRKAGLLSTDQLLFSDKRTSPFVDLFATQPFVFTSQFAVSMVKLGNVQVLTRPNEGEIRVNCNYVNRV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCACTACCTATCATTGTTCCTTCTTGTGATCATCTTAGAGCTAAGCACCAATGTCTATGGTCTCATGCCTAAAAGATCATTGAAGCCCTTATTACCACCTCCTGAAGCCTTG
CTTTCCATTGGTCACTATCATTCAACATGTCCAGATGCTGAAGGCATTATCTCACAAAAAGTTTTTGCTTGGGTTAAGAAGGACCCCACCTTGGCACCATCCATCATCCGCTTGCATTTT
CATGACTGTGCCGTTAGA
GTAATTTAATTAATCACATAACTCAATCTCTCTTTAAAGTTTACATTTATTTTTGGTCTGCACAATTATATCATATTATTTTTGACATCTATATCATGTACA
ATATTAATCTTAGTCTCTCAAAATAAAGACTAAAATCGATATTAGAGAGTGACTAATTTTTCTTATTGATTTAAAATGCAGGGATGTGATGGATCAATTTTACTTAACCATGTGGGAAGT
GAGAGAACTGCTTTTGCGAGTAAAACCTTGAGAGGGTTCCAATTGATTGATGAAATCAAAGCTGAACTAGAGAGAAGGTGTCCAAGAACAGTGTCATGTGCTGACATTCTCACTGCTGCT
ACAAGAGATGCAACCATTTTAGCAGGAGGACCATTTTGGGAAGTTCCATTCGGCCGAAAAGACGGCAAGATTTCAATAGCCAAAGAAGCCAATTTGGTTCCACAAGGACATGAAAATATC
ACAGGTTTGATTGGATTTTTTCAAGAAAGAGGACTTGACATGCTTGATTTGGTTACTCTCTCAGGTTCACACACAATTGGGAGAAGCACTTGTTATTCTGTTATGAATAGGATTTACAAT
TTCAATGGAACTGGTAAACCTGACCCATCACTTAACATCTATTACTTGAAGATGTTAAGGAAAAGATGTAAAAAGGATTTGGATTTGGTTCACCTTGATGTTATAACACCAAGGACTTTT
GACACAACCTATTACACAAACCTTAAGAGGAAGGCTGGATTGTTGTCAACAGATCAATTGTTGTTTTCAGATAAAAGAACATCTCCTTTTGTGGATTTATTTGCAACACAACCTTTTGTT
TTTACAAGTCAGTTTGCTGTGTCAATGGTGAAGCTTGGGAATGTTCAAGTTTTGACCAGGCCTAATGAAGGTGAGATCAGAGTGAATTGCAATTATGTCAATCGTGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCACTACCTATCATTGTTCCTTCTTGTGATCATCTTAGAGCTAAGCACCAATGTCTATGGTCTCATGCCTAAAAGATCATTGAAGCCCTTATTACCACCTCCTGAAGCCTTG
CTTTCCATTGGTCACTATCATTCAACATGTCCAGATGCTGAAGGCATTATCTCACAAAAAGTTTTTGCTTGGGTTAAGAAGGACCCCACCTTGGCACCATCCATCATCCGCTTGCATTTT
CATGACTGTGCCGTTAGA
GGATGTGATGGATCAATTTTACTTAACCATGTGGGAAGTGAGAGAACTGCTTTTGCGAGTAAAACCTTGAGAGGGTTCCAATTGATTGATGAAATCAAAGCT
GAACTAGAGAGAAGGTGTCCAAGAACAGTGTCATGTGCTGACATTCTCACTGCTGCTACAAGAGATGCAACCATTTTAGCAGGAGGACCATTTTGGGAAGTTCCATTCGGCCGAAAAGAC
GGCAAGATTTCAATAGCCAAAGAAGCCAATTTGGTTCCACAAGGACATGAAAATATCACAGGTTTGATTGGATTTTTTCAAGAAAGAGGACTTGACATGCTTGATTTGGTTACTCTCTCA
GGTTCACACACAATTGGGAGAAGCACTTGTTATTCTGTTATGAATAGGATTTACAATTTCAATGGAACTGGTAAACCTGACCCATCACTTAACATCTATTACTTGAAGATGTTAAGGAAA
AGATGTAAAAAGGATTTGGATTTGGTTCACCTTGATGTTATAACACCAAGGACTTTTGACACAACCTATTACACAAACCTTAAGAGGAAGGCTGGATTGTTGTCAACAGATCAATTGTTG
TTTTCAGATAAAAGAACATCTCCTTTTGTGGATTTATTTGCAACACAACCTTTTGTTTTTACAAGTCAGTTTGCTGTGTCAATGGTGAAGCTTGGGAATGTTCAAGTTTTGACCAGGCCT
AATGAAGGTGAGATCAGAGTGAATTGCAATTATGTCAATCGTGTTTAA

Retrieve as FASTA