Entry information : MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Entry ID 345
Creation 2005-09-13 (Christophe Dunand)
Last sequence changes 2011-07-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-07-29 (Christophe Dunand)
Peroxidase information: MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Name (synonym) MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Root tips
Inducers Nitrogen starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx18
start..stop
S start..stop
GmPrx[P]269 547 0 11..335 7..328
GmPrx167 544 0 19..335 18..340
PpePrx49 471 1e-168 40..333 41..335
CsaPrx34 459 9e-164 35..333 38..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55970927..55971184 258 N° 2 55971368..55972117 750  
join(55970927..55971184,55971368..55972117)


exon

Literature and cross-references MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Literature Journet,E.P. et al., unpublished, VandenBosch,K. et al., unpublished.
DNA ref. Phytozome 11:   chr4 (55970927..55972117)
Cluster/Prediction ref. Phytozome Gene 11:   31114037
Omic ref. Gene atlas:   Mtr.38220.1.S1_at Legoo:   Mtr.38220.1.S1_at
Protein sequence: MtPrx18 (Medtr4g133800.1[4.0] / Medtr4g133800.1 [3.5] / Medtr8g148530.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (312)
PWM (Da):   %s   37531.67 (34738.1) Transmb domain:   %s   i5-24o
PI (pH):   %s   9.34 (9.23) Peptide Signal:   %s   cut: 24 range:24-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFHYLSLFLLVIILELSTNVYGLMPKRSLKPLLPPPEALLSIGHYHSTCPDAEGIISQKVFAWVKKDPTLAPSIIRLHFHDCAVRGCDGSILLNHVGSERTAFASKTLRGFQLIDEIKAELERRCPRTVSCADILTAATRDATILAGGPFWEVPFGRKDGKISIAKEANLVPQGHENITGLIGFFQERGLDMLDLVTLSGSHTIGRSTCYSVMNRIYNFNGTGKPDPSLNIYYLKMLRKRCKKDLDLVHLDVITPRTFDTTYYTNLKRKAGLLSTDQLLFSDKRTSPFVDLFATQPFVFTSQFAVSMVKLGNVQVLTRPNEGEIRVNCNYVNRV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCACTACCTATCATTGTTCCTTCTTGTGATCATCTTAGAGCTAAGCACCAATGTCTATGGTCTCATGCCTAAAAGATCATTGAAGCCCTTATTACCACCTCCTGAAGCCTTG
CTTTCCATTGGTCACTATCATTCAACATGTCCAGATGCTGAAGGCATTATCTCACAAAAAGTTTTTGCTTGGGTTAAGAAGGACCCCACCTTGGCACCATCCATCATCCGCTTGCATTTT
CATGACTGTGCCGTTAGA
GTAATTTAATTAATCACATAACTCAATCTCTCTTTAAAGTTTACATTTATTTTTGGTCTGCACAATTATATCATATTATTTTTGACATCTATATCATGTACA
ATATTAATCTTAGTCTCTCAAAATAAAGACTAAAATCGATATTAGAGAGTGACTAATTTTTCTTATTGATTTAAAATGCAGGGATGTGATGGATCAATTTTACTTAACCATGTGGGAAGT
GAGAGAACTGCTTTTGCGAGTAAAACCTTGAGAGGGTTCCAATTGATTGATGAAATCAAAGCTGAACTAGAGAGAAGGTGTCCAAGAACAGTGTCATGTGCTGACATTCTCACTGCTGCT
ACAAGAGATGCAACCATTTTAGCAGGAGGACCATTTTGGGAAGTTCCATTCGGCCGAAAAGACGGCAAGATTTCAATAGCCAAAGAAGCCAATTTGGTTCCACAAGGACATGAAAATATC
ACAGGTTTGATTGGATTTTTTCAAGAAAGAGGACTTGACATGCTTGATTTGGTTACTCTCTCAGGTTCACACACAATTGGGAGAAGCACTTGTTATTCTGTTATGAATAGGATTTACAAT
TTCAATGGAACTGGTAAACCTGACCCATCACTTAACATCTATTACTTGAAGATGTTAAGGAAAAGATGTAAAAAGGATTTGGATTTGGTTCACCTTGATGTTATAACACCAAGGACTTTT
GACACAACCTATTACACAAACCTTAAGAGGAAGGCTGGATTGTTGTCAACAGATCAATTGTTGTTTTCAGATAAAAGAACATCTCCTTTTGTGGATTTATTTGCAACACAACCTTTTGTT
TTTACAAGTCAGTTTGCTGTGTCAATGGTGAAGCTTGGGAATGTTCAAGTTTTGACCAGGCCTAATGAAGGTGAGATCAGAGTGAATTGCAATTATGTCAATCGTGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCACTACCTATCATTGTTCCTTCTTGTGATCATCTTAGAGCTAAGCACCAATGTCTATGGTCTCATGCCTAAAAGATCATTGAAGCCCTTATTACCACCTCCTGAAGCCTTG
CTTTCCATTGGTCACTATCATTCAACATGTCCAGATGCTGAAGGCATTATCTCACAAAAAGTTTTTGCTTGGGTTAAGAAGGACCCCACCTTGGCACCATCCATCATCCGCTTGCATTTT
CATGACTGTGCCGTTAGA
GGATGTGATGGATCAATTTTACTTAACCATGTGGGAAGTGAGAGAACTGCTTTTGCGAGTAAAACCTTGAGAGGGTTCCAATTGATTGATGAAATCAAAGCT
GAACTAGAGAGAAGGTGTCCAAGAACAGTGTCATGTGCTGACATTCTCACTGCTGCTACAAGAGATGCAACCATTTTAGCAGGAGGACCATTTTGGGAAGTTCCATTCGGCCGAAAAGAC
GGCAAGATTTCAATAGCCAAAGAAGCCAATTTGGTTCCACAAGGACATGAAAATATCACAGGTTTGATTGGATTTTTTCAAGAAAGAGGACTTGACATGCTTGATTTGGTTACTCTCTCA
GGTTCACACACAATTGGGAGAAGCACTTGTTATTCTGTTATGAATAGGATTTACAATTTCAATGGAACTGGTAAACCTGACCCATCACTTAACATCTATTACTTGAAGATGTTAAGGAAA
AGATGTAAAAAGGATTTGGATTTGGTTCACCTTGATGTTATAACACCAAGGACTTTTGACACAACCTATTACACAAACCTTAAGAGGAAGGCTGGATTGTTGTCAACAGATCAATTGTTG
TTTTCAGATAAAAGAACATCTCCTTTTGTGGATTTATTTGCAACACAACCTTTTGTTTTTACAAGTCAGTTTGCTGTGTCAATGGTGAAGCTTGGGAATGTTCAAGTTTTGACCAGGCCT
AATGAAGGTGAGATCAGAGTGAATTGCAATTATGTCAATCGTGTTTAA

Retrieve as FASTA