Entry information : MtPrx20 (Medtr2g029830.1 [4.0] / Medtr2g029830.1 [3.5])
Entry ID 346
Creation 2009-01-02 (Christophe Dunand)
Last sequence changes 2011-07-13 (Qiang Li)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtPrx20 (Medtr2g029830.1 [4.0] / Medtr2g029830.1 [3.5])
Name (synonym) MtPrx20 (Medtr2g029830.1 [4.0] / Medtr2g029830.1 [3.5])
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Leaves
Inducers Colletotrichum inoculation
Drought
Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Methyl jasmonate treatment
Pathogen interaction
Virus infection
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx20
start..stop
S start..stop
MsPrx03 679 0 1..355 1..358
MsPrx14 653 0 8..355 1..347
MsPrx02 589 0 1..353 1..353
MtPrx11 583 0 1..354 1..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11154682..11154900 219 N° 2 11155566..11155757 192 N° 3 11156177..11156342 166 N° 4 11156433..11156923 491
join(11154682..11154900,11155566..11155757,11156177..11156342,11156433..11156923 )


exon

Literature and cross-references MtPrx20 (Medtr2g029830.1 [4.0] / Medtr2g029830.1 [3.5])
Literature Korth,K. et al., unpublished, Torres-Jerez,I. et al., unpublished.
DNA ref. Phytozome 11:   chr2 (11154682..11156923)
Cluster/Prediction ref. Phytozome Gene 11:   31066768 UniGene:   Mtr.13229
Omic ref. Gene atlas:   Mtr.40121.1.S1_at Legoo:   Mtr.40121.1.S1_at
Protein sequence: MtPrx20 (Medtr2g029830.1 [4.0] / Medtr2g029830.1 [3.5])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 355 (329)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
37742.01 (35050.7)  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.49 (6.88) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 27 range:27-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSLATSMWCVVLLVVLGGLPFSSDAQLSPTFYSKTCPTVSSIVSNVLTNVSKTDQRMLASLVRLHFHDCFVLGCDASVLLNNTATIVSEQQAFPNNNSLRGLDVVNQIKTAIESACPNTVSCADILALAAQASSVLAQGPSWTVPLGRRDGLTANRTLANQNLPAPFNTLVQLKAAFTAQGLNTTDLVALSGAHTFGRAHCAQFVGRLYNFSSTGSPDPTLNTTYLQQLRTICPNGGPGTNLTNFDPTTPDKFDKNYYSNLQVKKGLLQSDQELFSTSGADTISIVNKFSTDQNAFFESFKAAMIKMGNIGVLTGTKGEIRKQCNFVNSNSAELDLATIASIVESLEDGIASVI

Retrieve as FASTA  
Remarks Complete sequence from 23 ESTs and genomic (chromo 2, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCTTAGCAACTTCTATGTGGTGTGTTGTGCTTTTGGTTGTGCTTGGAGGACTACCCTTTTCCTCAGATGCACAACTTAGTCCCACTTTTTACAGCAAAACTTGTCCAACTGTT
AGTTCCATTGTTAGCAATGTATTAACAAATGTTTCTAAGACAGATCAACGCATGCTTGCTAGCCTCGTCAGGCTTCACTTTCATGACTGTTTTGTTTTG
GTATGTCTTTAGGTGACTACT
TTATATTTCTAATATTATCTTTAGATTTATAAATATTAGTTTAAAATATATTATAATACAATATGGTTAGTTCGATCCATGCGCAACTCCTATATATTATACAACTAAAAATGGTAAATA
ATTGTCTACTACAACTGATCAACAGACGTTTCCTAAAAAAAACGTCAATTAGATATATCTTCATTTGTCCCTTTGAAATTAACTGTCTTTTGATCGAACTTTTATTATAATGTCCCTTTT
ACAAAATAGAAGGATTAGAACAAAGAAACAATAGAAAAATAATTCTTAAACACCTAAAACCATTCTACCATTAAAGAAAGAAGAAATAAATGGAAATAATATATGTGATAGGTTGTTGAT
ATAATAGGAAGAGAGAGATGAAGAGAAAATAAATGTAGAAGTAGAATGTACGTAAGAAAAGTAAGAGAGATGCAAATAGGGTTCTAATAATTGTCTTGCACTTCTTTTCTTTATATTTTA
TAAAATTATGCATTAACTAGTATTTTCTAAAAATTGTAGGCCAAGTATATGAATCAACTTTCTTTTTTAAGTTTTTAACTTTCAAGTAAATTTTTAATATGCTTTTTTACCATATGTTCT
TTAATTTATGCGTCAAAAAATAATGTGATGCATAATTTTCACAGGGATGTGATGCCTCGGTTTTGTTGAACAATACTGCTACGATCGTAAGCGAACAACAAGCTTTTCCAAATAACAACT
CTTTAAGAGGTTTGGATGTTGTAAATCAGATCAAAACTGCTATAGAAAGTGCTTGTCCTAACACAGTTTCTTGTGCTGATATTCTTGCTCTTGCTGCTCAAGCATCCTCTGTTCTG
GTAC
ATATGCCCTAATTCTAAATATATTTCTGTAATTTAATGCCTCGTTGATCATTAAATTTCAAATGCAATATTTAAATGATTCTATTTCTGTTCTGAGTATATAATACTATAATATATGCAT
TTGATAATGGTTGCAATCCAACAAAAATGATCATATAGTTAATTAAGGTAGCGGCGCCGTCTGTATTTTGTTTTCAGTTTTTGCCGCGAGTTTTTATGCGCCTTGCATTTACTCGACGTG
AATAAATTTTCCGTTTCAAAAAAAAAAGTTAATTAAGGTAGCTTCAAAATCTAGGGTTATTTTTATAATGATTAAATAAAAAAACCATTTCAAGAAGTTAATCATCTATGAAAATTAAAT
ACTACATCACAAGGCTAAGAGTAACACTTATTTTACCTATGATGAAATAATACAGGCACAAGGTCCTAGTTGGACAGTTCCTTTAGGAAGAAGGGATGGTTTAACTGCAAACCGGACACT
TGCAAATCAAAATCTTCCGGCCCCATTCAATACCTTGGTTCAACTTAAAGCTGCATTTACTGCCCAAGGCCTGAATACTACTGATCTAGTTGCACTCTCGG
GTTTGTGCTCATTTTAGCG
ATGATGTTGACGTTACATAAAATAAAAATTATATATATGATTATTGATTTATATATGTTTCTCGTTTTCAGGTGCTCATACGTTTGGAAGAGCTCATTGCGCACAATTTGTTGGTCGATT
GTACAACTTCAGCAGTACTGGAAGTCCGGATCCAACTCTTAACACAACTTACTTACAACAATTGCGCACAATATGTCCCAATGGTGGACCTGGCACGAACCTTACCAATTTCGATCCAAC
GACTCCTGATAAATTTGACAAGAACTATTACTCCAATCTTCAAGTGAAAAAGGGCTTGCTCCAAAGTGATCAAGAGTTGTTCTCAACATCCGGTGCAGATACCATTAGCATTGTCAACAA
ATTCAGCACCGATCAAAACGCTTTCTTTGAGAGCTTTAAGGCTGCAATGATTAAAATGGGCAATATTGGTGTGCTAACAGGGACGAAAGGAGAGATTAGAAAACAATGCAACTTTGTTAA
CTCAAATTCTGCAGAACTAGATTTAGCCACTATAGCCTCCATAGTAGAATCATTAGAGGATGGTATTGCTAGTGTAATATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCTTAGCAACTTCTATGTGGTGTGTTGTGCTTTTGGTTGTGCTTGGAGGACTACCCTTTTCCTCAGATGCACAACTTAGTCCCACTTTTTACAGCAAAACTTGTCCAACTGTT
AGTTCCATTGTTAGCAATGTATTAACAAATGTTTCTAAGACAGATCAACGCATGCTTGCTAGCCTCGTCAGGCTTCACTTTCATGACTGTTTTGTTTTG
GGATGTGATGCCTCGGTTTTG
TTGAACAATACTGCTACGATCGTAAGCGAACAACAAGCTTTTCCAAATAACAACTCTTTAAGAGGTTTGGATGTTGTAAATCAGATCAAAACTGCTATAGAAAGTGCTTGTCCTAACACA
GTTTCTTGTGCTGATATTCTTGCTCTTGCTGCTCAAGCATCCTCTGTTCTG
GCACAAGGTCCTAGTTGGACAGTTCCTTTAGGAAGAAGGGATGGTTTAACTGCAAACCGGACACTTGCA
AATCAAAATCTTCCGGCCCCATTCAATACCTTGGTTCAACTTAAAGCTGCATTTACTGCCCAAGGCCTGAATACTACTGATCTAGTTGCACTCTCGG
GTGCTCATACGTTTGGAAGAGCT
CATTGCGCACAATTTGTTGGTCGATTGTACAACTTCAGCAGTACTGGAAGTCCGGATCCAACTCTTAACACAACTTACTTACAACAATTGCGCACAATATGTCCCAATGGTGGACCTGGC
ACGAACCTTACCAATTTCGATCCAACGACTCCTGATAAATTTGACAAGAACTATTACTCCAATCTTCAAGTGAAAAAGGGCTTGCTCCAAAGTGATCAAGAGTTGTTCTCAACATCCGGT
GCAGATACCATTAGCATTGTCAACAAATTCAGCACCGATCAAAACGCTTTCTTTGAGAGCTTTAAGGCTGCAATGATTAAAATGGGCAATATTGGTGTGCTAACAGGGACGAAAGGAGAG
ATTAGAAAACAATGCAACTTTGTTAACTCAAATTCTGCAGAACTAGATTTAGCCACTATAGCCTCCATAGTAGAATCATTAGAGGATGGTATTGCTAGTGTAATATAA

Retrieve as FASTA