Entry information : MtPrx22 (Medtr5g083860.1[4.0] / Medtr5g083860.1[3.5] / Medtr5g091290.1[3.0])
Entry ID 348
Creation 2006-01-30 (Christophe Dunand)
Last sequence changes 2010-09-15 (Haythem Mhadhbi)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx22 (Medtr5g083860.1[4.0] / Medtr5g083860.1[3.5] / Medtr5g091290.1[3.0])
Name (synonym) MtPrx22 (Medtr5g083860.1[4.0] / Medtr5g083860.1[3.5] / Medtr5g091290.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Cell culture
Roots
Roots nodules
Inducers Aphanomyces euteiches zoospores infection
Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Glucose treatment
Methyl jasmonate treatment
Phytophthora infection
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx22
start..stop
S start..stop
GmPrx328 548 0 1..325 1..320
GmPrx158 543 0 1..325 1..320
GmPrx80 531 0 1..325 1..324
GmPrx61 527 0 1..325 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36189415..36189642 228 N° 2 36190222..36190413 192 N° 3 36190637..36190802 166 N° 4 36191002..36191393 392
join(36189415..36189642,36190222..36190413,36190637..36190802,36191002..36191393 )


exon

Literature and cross-references MtPrx22 (Medtr5g083860.1[4.0] / Medtr5g083860.1[3.5] / Medtr5g091290.1[3.0])
Literature Torres-Jerez,I. et al., unpublished
DNA ref. Phytozome 12:   chr5 (36189415..36191393)
EST ref. GenBank:   EY476317.1 [5' end]   CA919059.1 [3' end]
Cluster/Prediction ref. Phytozome Gene 12:   31088351 UniGene:   Mtr.12150
Omic ref. Gene atlas:   Mtr.40611.1.S1_at Legoo:   Mtr.40611.1.S1_at
Protein sequence: MtPrx22 (Medtr5g083860.1[4.0] / Medtr5g083860.1[3.5] / Medtr5g091290.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (296)
PWM (Da):   %s   34843.15 (31804.7)  
PI (pH):   %s   7.34 (7.38) Peptide Signal:   %s   cut: 30 range:30-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFCFSMTSNLMICFSLLVLVSIGSANANLSKDYYYSSCPKLFETVKCEVQSAISKETRMGASLLRLFFHDCFVNGCDGSILLDDTSSFTGEKTANPNKNSARGFEVIDKIKSAVEKVCPGAVSCADILTITARDSVEILGGPTWDVKLGRRDARTASKSAANNDIPAPTSSLNQLISRFNALGLSTKDLVALSGGHTIGQARCTTFRAHIYNDSNIDTSFARTRQSGCPKTSGSGDNNLAPLDLATPTSFDNHYFKNLVDSKGLLHSDQQLFNGGSTDSIVHEYSLYPSSFSSDFVTAMIKMGDISPLTGSNGEIRKQCRSVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 19 ESTs. Cultivar="A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTTTGTTTTAGCATGACAAGTAATTTAATGATATGTTTTTCCCTTTTGGTTCTTGTATCAATTGGGAGTGCCAATGCTAATCTTTCGAAAGATTATTACTATAGTTCTTGT
CCAAAACTATTTGAAACTGTTAAGTGTGAAGTTCAATCTGCCATATCAAAAGAGACTCGCATGGGTGCTTCTCTTCTGCGTTTGTTCTTCCACGATTGCTTTGTTAAT
GTACTCATTTTT
TTCTTCTCTCTCACTTACATTCAATTACATTTTATATAACACACACACACACATATATATATATATAGATAGATAAACAAAAGTCGATGTATGTCATTTAAATTTTAAACGAGATGCATG
AACTTTTATTGACTCAAATGTATCTTATAAATATGACAAAATAAAGCAACATAAATATAGAATGATTTCCCACTAACGGTTTGGTTTACCTACTTTGAATTTTTTTAAAAATGCTTTTGT
TTCTGTCAATATAATTTATTAACAATATTGACTTATGGTTTCTTAGTCTGGTATAGTGATGACATGCTAGTTTAATTAATTGGGATGAATAATCTAACCTCTTTGATGCTACTTGCTTTT
GCTTAAAAAATTAATGTGATCATAGGATTGGATATTGTGTACAACTCGTTTTCTTTAATACAAATTTAATTATAAAAAAATATGAATATTTTTAATATAAAATGTACCAAATATGACTAT
TATTATGAGATTGAGAGAGTATTATATATTTTCTAAGGACTATACAATTCATTGGCAAATTTGAATTGAATAAATAAACCATTGCAGGGATGTGATGGTTCAATTCTTCTCGATGACACA
TCAAGCTTCACCGGAGAGAAAACTGCCAATCCCAACAAAAATTCGGCCCGTGGATTCGAAGTGATCGACAAAATCAAATCAGCAGTGGAGAAAGTATGTCCAGGTGCAGTTTCATGCGCT
GACATCCTTACCATCACTGCTAGAGACTCTGTTGAGATC
GTAAGTATCCACCAAAATTGCATCATAATATTCATATTAACCAAAAACATAAAATTTGATCAAATTTTAATATTTTCCTAT
ACATTTTAGAGAATAAAGTTATTAAAATCTCAATATAATACCTAATTGAACAATCAATGTAAAACTATTTTACACCGTGAGTGAATACAAATATAAATATATTGTATAAATTATGCTAAT
TGATTATGCTTAAATTTCCCAGCTTGGAGGCCCAACATGGGATGTGAAACTTGGAAGAAGAGATGCAAGAACAGCTAGTAAATCAGCTGCAAACAATGACATCCCAGCACCCACTTCAAG
CCTCAACCAACTCATCTCAAGGTTTAATGCTCTTGGTCTTTCCACCAAGGATTTGGTCGCATTGTCTG
GTATGCAACATTGATTATAATCTTTTTTTGAGAAATGTGAACTTGTGTCCAA
AGATATAAGTTTAGTAACTAAACATAGAAGTTTTTTTTTTTTTTTTTCCTCATAAAAATGGTGTATTAAATATTTTAAAGGTTTAAATTTTTATCTTTTCATTGGTTGTTTGAGTAAATC
TTGATTTTTAAATGATGCTTGGACTAGGGGGTCACACAATTGGACAAGCAAGGTGCACTACATTTAGAGCCCACATTTACAACGACTCCAACATAGATACTTCCTTTGCTCGCACAAGGC
AATCAGGGTGCCCCAAGACATCGGGTTCCGGGGACAATAATTTGGCACCCCTTGATCTTGCAACACCAACATCCTTTGACAACCATTACTTCAAGAACCTAGTTGACAGTAAGGGACTAC
TCCACTCCGACCAACAACTCTTTAATGGTGGATCCACCGATTCCATAGTGCACGAATATAGCTTGTATCCAAGCTCTTTTTCCTCTGATTTCGTCACCGCCATGATCAAGATGGGAGACA
TTAGTCCCCTCACCGGTTCAAATGGAGAGATAAGAAAGCAATGCAGGAGCGTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTTTGTTTTAGCATGACAAGTAATTTAATGATATGTTTTTCCCTTTTGGTTCTTGTATCAATTGGGAGTGCCAATGCTAATCTTTCGAAAGATTATTACTATAGTTCTTGT
CCAAAACTATTTGAAACTGTTAAGTGTGAAGTTCAATCTGCCATATCAAAAGAGACTCGCATGGGTGCTTCTCTTCTGCGTTTGTTCTTCCACGATTGCTTTGTTAAT
GGATGTGATGGT
TCAATTCTTCTCGATGACACATCAAGCTTCACCGGAGAGAAAACTGCCAATCCCAACAAAAATTCGGCCCGTGGATTCGAAGTGATCGACAAAATCAAATCAGCAGTGGAGAAAGTATGT
CCAGGTGCAGTTTCATGCGCTGACATCCTTACCATCACTGCTAGAGACTCTGTTGAGATC
CTTGGAGGCCCAACATGGGATGTGAAACTTGGAAGAAGAGATGCAAGAACAGCTAGTAAA
TCAGCTGCAAACAATGACATCCCAGCACCCACTTCAAGCCTCAACCAACTCATCTCAAGGTTTAATGCTCTTGGTCTTTCCACCAAGGATTTGGTCGCATTGTCTG
GGGGTCACACAATT
GGACAAGCAAGGTGCACTACATTTAGAGCCCACATTTACAACGACTCCAACATAGATACTTCCTTTGCTCGCACAAGGCAATCAGGGTGCCCCAAGACATCGGGTTCCGGGGACAATAAT
TTGGCACCCCTTGATCTTGCAACACCAACATCCTTTGACAACCATTACTTCAAGAACCTAGTTGACAGTAAGGGACTACTCCACTCCGACCAACAACTCTTTAATGGTGGATCCACCGAT
TCCATAGTGCACGAATATAGCTTGTATCCAAGCTCTTTTTCCTCTGATTTCGTCACCGCCATGATCAAGATGGGAGACATTAGTCCCCTCACCGGTTCAAATGGAGAGATAAGAAAGCAA
TGCAGGAGCGTGAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGACAAACAC AAACACAAAT ACAAAACCTT CTTAATTGTA CTTTTGTACT TTAGCAATTA TCTAGTTTAT TACATGGCTT CGTTTTGTTT TAGCATGACA AGTAATTTAA TGATATGTTT  TTCCCTTTTG GTTCTTGTAT CAATTGGGAG TGCCAATGCT AATCTTTCGA AAGATTATTA CTATAGTTCT TGTCCAAAAC TATTTGAAAC TGTTAAGTGT GAAGTTCAAT CTGCCATATC  AAAAGAGACT CGCATGGGTG CTTCTCTTCT GCGTTTGTTC TTCCACGATT GCTTTGTTAA TGGATGTGAT GGTTCAATTC TTCTCGATGA CACATCAAGC TTCACCGGAG AGAAAACTGC  CAATCCCAAC AAAAATTCGG CCCGTGGATT CGAAGTGATC GACAAAATCA AATCAGCAGT GGAGAAAGTA TGTCCAGGTG CAGTTTCATG CGCTGACATC CTTACCATCA CTGCTAGAGA  CTCTGTTGAG ATCCTTGGAG GCCCAACATG GGATGTGAAA CTTGGAAGAA GAGATGCAAG AACAGCTAGT AAATCAGCTG CAAACAATGA CATCCCAGCA CCCACTTCAA GCCTCAACCA  ACTCATCTCA AGGTTTAATG CTCTTGGTCT TTCCACCAAG GATTTGGTCG CATTGTCTGG GGGTCACACA ATTGGACAAG CAAGGTGCAC TACATTTAGA GCCCACATTT ACAACGACTC  CAACATAGAT ACTTCCTTTG CTCGCACAAG GCAATCAGGG TGCCCCAAGA CATCGGGTTC CGGGGACAAT AATTTGGCAC CCCTTGATCT TGCAACACCA ACATCCTTTG ACAACCATTA  CTTCAAGAAC CTAGTTGACA GTAAGGGACT ACTCCACTCC GACCAACAAC TCTTTAATGG TGGATCCACC GATTCCATAG TGCACGAATA TAGCTTGTAT CCAAGCTCTT TTTCCTCTGA  TTTCGTCACC GCCATGATCA AGATGGGAGA CATTAGTCCC CTCACCGGTT CAAATGGAGA GATAAGAAAG CAATGCAGGA GCGTGAATTA ACCTATTTAA TTTTTTGTTG GACCAAATGC  ATGTATCTTT TTATTTATAT TTAAGTCTGG ACGGAGTATA TTGTATTTTA ATTAAGTTTT CTTGTACTTT ATTTTGTTGG TCTCATGTTT CAAGTATTGT GTTTTGTCTC ATTATTATTT 
TGATTCCAAG TGTGAATGTT GAAGGATAAA ATTTCTTATA TTTTAAGGTT TGTTTT 

Retrieve as FASTA