Entry information : MtPrx23 (Medtr7g093370.1[4.0] / Medtr7g093370.1[3.5] / Medtr7g112100.1[3.0])
Entry ID 349
Creation 2005-09-13 (Christophe Dunand)
Last sequence changes 2013-12-12 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx23 (Medtr7g093370.1[4.0] / Medtr7g093370.1[3.5] / Medtr7g112100.1[3.0])
Name (synonym) MtPrx23 (Medtr7g093370.1[4.0] / Medtr7g093370.1[3.5] / Medtr7g112100.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Pods
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx23
start..stop
S start..stop
GmPrx136 580 0 46..373 4..330
GmPrx310 563 0 51..373 6..331
GmPrx38 545 0 45..373 1..331
GmPrx71 542 0 45..373 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37110748..37111089 342 N° 2 37111172..37111366 195 N° 3 37111491..37111656 166 N° 4 37111891..37112309 419
join(37110748..37111089,37111172..37111366,37111491..37111656,37111891..37112309 )


exon

Literature and cross-references MtPrx23 (Medtr7g093370.1[4.0] / Medtr7g093370.1[3.5] / Medtr7g112100.1[3.0])
Literature Harrison,M.J. et al., unpublished
DNA ref. Phytozome 11:   chr7 (37110748..37112309)
Cluster/Prediction ref. Phytozome Gene 11:   31077007
Omic ref. Gene atlas:   Mtr.12601.1.S1_at Legoo:   Mtr.12601.1.S1_at
Protein sequence: MtPrx23 (Medtr7g093370.1[4.0] / Medtr7g093370.1[3.5] / Medtr7g112100.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373
PWM (Da):   %s   40345.16  
PI (pH):   %s   8.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNYPMKTLTSSIIEDRHSSIYIPYQLLRYFIKKSNSKEETKKPTMFSPKFYSIFTVLIFLLLNPSHAQLTSTFYSNTCPSVSSIVRNVVQQALQNDPRITASLTRLHFHDCFVNGCDASLLLDQGGNITLSEKNAVPNNNSARGFDVVDKIKTSVENSCPSVVSCADILALAAEASVSLSGGPSWNVLLGRRDGLIANQSGANTSIPNPTESLANVTAKFAAVGLNTSDLVALSGAHTFGRGQCRFFNQRLFNFSGTGKPDPTLNSTYLATLQQNCPQNGSGNTLNNLDPSSPNNFDNNYFKNLLKNQGLLQTDQELFSTNGAATISIVNNFASNQTAFFEAFVQSMINMGNISPLIGSQGEIRSDCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from 17 ESTs and genomic sequence (chromo 7, 3 introns). Very long PS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTACCCAATGAAAACTTTAACTTCAAGCATAATTGAAGACAGACATTCTTCAATATATATACCTTATCAACTCCTCAGATATTTCATCAAGAAATCAAACTCCAAAGAAGAAACT
AAGAAGCCAACCATGTTTTCTCCTAAATTTTATTCCATTTTCACAGTGCTAATATTCCTCCTTCTTAATCCATCACATGCTCAATTGACCTCAACATTCTACTCCAACACATGCCCCAGT
GTTTCTTCTATAGTAAGAAATGTTGTTCAACAAGCTCTGCAAAATGATCCTCGTATTACCGCGAGCCTAACCCGTCTTCACTTTCACGATTGCTTTGTTAAT
GTAATTTCTTATACATTT
TGATTAATGAGCCAGAATTTAGGTGATTGATTAATAACTAATGTCCTTAATTTGTGTATTGCAGGGATGTGATGCATCTCTTTTATTAGATCAAGGTGGAAACATAACACTAAGTGAGAA
AAATGCTGTTCCTAACAATAATTCAGCTCGTGGCTTTGATGTAGTTGACAAAATCAAAACCTCTGTTGAAAATTCATGTCCTTCTGTCGTGTCTTGTGCTGATATTTTGGCTCTTGCTGC
TGAAGCTTCTGTATCTTTG
GTACCTAATTCATATCTAGTTAATTATTTATCATTACTAATTTTATCCTCAAGTCTACGAGTCGAGTTTAAAGACTTTTTTTCGAGTCTATGTAGACTCGC
GAGTCTAACAATCTTGTTTGCAGTCAGGAGGTCCTTCATGGAATGTACTACTTGGCAGAAGGGATGGTCTGATTGCAAACCAATCTGGTGCCAACACATCCATTCCTAATCCAACTGAAA
GCTTAGCCAATGTCACTGCCAAATTTGCTGCTGTTGGCTTAAACACAAGTGATCTAGTTGCATTATCTG
GTAATCACACTTACTTCTCTAATCTAGACTTTAATTAGAGTATGTTGGATT
AGGACATATAAATTTCAACAATTGTATCTAATGGTGGAAATTTGACCGTACGACAGGATGTTTGAAGGGATTCATAGCAAAGAAGTTTTGTAGAAAATTATTGATTTTTTCATTATGTGT
ATGATAATTAATAAGCATTTTTTTTTAACTATTGGTTGACTCAAATGGATCAACTTGAATTAGGTGCACATACTTTTGGTCGTGGACAATGTAGATTTTTCAACCAAAGACTATTCAACT
TCAGTGGCACAGGCAAGCCTGATCCAACACTAAATTCAACATATCTAGCAACTCTACAACAAAATTGTCCACAAAATGGAAGTGGTAACACACTAAACAATCTTGACCCTTCATCACCAA
ACAATTTCGACAACAACTACTTCAAAAATCTTCTCAAAAATCAAGGTCTTCTTCAAACGGACCAAGAATTGTTTTCCACTAATGGTGCTGCTACAATCTCCATTGTTAACAACTTTGCAA
GCAACCAAACAGCTTTTTTTGAAGCCTTTGTTCAGTCCATGATTAACATGGGTAATATTAGTCCATTAATTGGAAGTCAAGGAGAAATTAGATCCGATTGTAAGAAAGTTAATGGAAGTT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTACCCAATGAAAACTTTAACTTCAAGCATAATTGAAGACAGACATTCTTCAATATATATACCTTATCAACTCCTCAGATATTTCATCAAGAAATCAAACTCCAAAGAAGAAACT
AAGAAGCCAACCATGTTTTCTCCTAAATTTTATTCCATTTTCACAGTGCTAATATTCCTCCTTCTTAATCCATCACATGCTCAATTGACCTCAACATTCTACTCCAACACATGCCCCAGT
GTTTCTTCTATAGTAAGAAATGTTGTTCAACAAGCTCTGCAAAATGATCCTCGTATTACCGCGAGCCTAACCCGTCTTCACTTTCACGATTGCTTTGTTAAT
GGATGTGATGCATCTCTT
TTATTAGATCAAGGTGGAAACATAACACTAAGTGAGAAAAATGCTGTTCCTAACAATAATTCAGCTCGTGGCTTTGATGTAGTTGACAAAATCAAAACCTCTGTTGAAAATTCATGTCCT
TCTGTCGTGTCTTGTGCTGATATTTTGGCTCTTGCTGCTGAAGCTTCTGTATCTTTG
TCAGGAGGTCCTTCATGGAATGTACTACTTGGCAGAAGGGATGGTCTGATTGCAAACCAATCT
GGTGCCAACACATCCATTCCTAATCCAACTGAAAGCTTAGCCAATGTCACTGCCAAATTTGCTGCTGTTGGCTTAAACACAAGTGATCTAGTTGCATTATCTG
GTGCACATACTTTTGGT
CGTGGACAATGTAGATTTTTCAACCAAAGACTATTCAACTTCAGTGGCACAGGCAAGCCTGATCCAACACTAAATTCAACATATCTAGCAACTCTACAACAAAATTGTCCACAAAATGGA
AGTGGTAACACACTAAACAATCTTGACCCTTCATCACCAAACAATTTCGACAACAACTACTTCAAAAATCTTCTCAAAAATCAAGGTCTTCTTCAAACGGACCAAGAATTGTTTTCCACT
AATGGTGCTGCTACAATCTCCATTGTTAACAACTTTGCAAGCAACCAAACAGCTTTTTTTGAAGCCTTTGTTCAGTCCATGATTAACATGGGTAATATTAGTCCATTAATTGGAAGTCAA
GGAGAAATTAGATCCGATTGTAAGAAAGTTAATGGAAGTTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTACC CAATGAAAAC TTTAACTTCA AGCATAATTG AAGACAGACA TTCTTCAATA TATATACCTT ATCAACTCCT CAGATATTTC ATCAAGAAAT CAAACTCCAA AGAAGAAACT  AAGAAGCCAA CCATGTTTTC TCCTAAATTT TATTCCATTT TCACAGTGCT AATATTCCTC CTTCTTAATC CATCACATGC TCAATTGACC TCAACATTCT ACTCCAACAC ATGCCCCAGT  GTTTCTTCTA TAGTAAGAAA TGTTGTTCAA CAAGCTCTGC AAAATGATCC TCGTATTACC GCGAGCCTAA CCCGTCTTCA CTTTCACGAT TGCTTTGTTA ATGGATGTGA TGCATCTCTT  TTATTAGATC AAGGTGGAAA CATAACACTA AGTGAGAAAA ATGCTGTTCC TAACAATAAT TCAGCTCGTG GCTTTGATGT AGTTGACAAA ATCAAAACCT CTGTTGAAAA TTCATGTCCT  TCTGTCGTGT CTTGTGCTGA TATTTTGGCT CTTGCTGCTG AAGCTTCTGT ATCTTTGTCA GGAGGTCCTT CATGGAATGT ACTACTTGGC AGAAGGGATG GTCTGATTGC AAACCAATCT  GGTGCCAACA CATCCATTCC TAATCCAACT GAAAGCTTAG CCAATGTCAC TGCCAAATTT GCTGCTGTTG GCTTAAACAC AAGTGATCTA GTTGCATTAT CTGGTGCACA TACTTTTGGT  CGTGGACAAT GTAGATTTTT CAACCAAAGA CTATTCAACT TCAGTGGCAC AGGCAAGCCT GATCCAACAC TAAATTCAAC ATATCTAGCA ACTCTACAAC AAAATTGTCC ACAAAATGGA  AGTGGTAACA CACTAAACAA TCTTGACCCT TCATCACCAA ACAATTTCGA CAACAACTAC TTCAAAAATC TTCTCAAAAA TCAAGGTCTT CTTCAAACGG ACCAAGAATT GTTTTCCACT  AATGGTGCTG CTACAATCTC CATTGTTAAC AACTTTGCAA GCAACCAAAC AGCTTTTTTT GAAGCCTTTG TTCAGTCCAT GATTAACATG GGTAATATTA GTCCATTAAT TGGAAGTCAA  GGAGAAATTA GATCCGATTG TAAGAAAGTT AATGGAAGTT GAAATGGGGA GGATCGTCAT GCATGCATGA TAGTATATGT ACAAGATATT CTTACTCCAA CTTATATGCT CAAACTTTAA  GACCTTATTT GTGTGATCTG ATTTAATAAA ATAAGGTAAA ATTGCTTTAT CATTTTTTTT TTTTGGGTTG ATAAAATTGT TTTTTGTTTT TGTTTTGAGA GGATTGATAA AATTGTTTAT 
CAATATTAAA TAAAATAATG TTTGTGTTGG CCG 

Retrieve as FASTA