Entry information : SbAPx01 (Sobic.001G410200.1 [2.1] / Sb01g038760 [1.4])
Entry ID 3502
Creation 2006-08-23 (Felipe Teixeira)
Last sequence changes 2006-08-23 (Felipe Teixeira)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbAPx01 (Sobic.001G410200.1 [2.1] / Sb01g038760 [1.4])
Name (synonym) SbAPx01 (Sobic.001G410200.1 [2.1] / Sb01g038760 [1.4])
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation Cytosolic
Tissue types Callus
Flowers
Inflorescences
Leaves
Roots
Seedlings
Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx01
start..stop
S start..stop
ZmAPx05 494 1e-180 1..250 1..250
ZmAPx01 493 4e-180 1..250 1..250
SiAPx01 491 4e-179 1..250 1..250
PamAPx01 484 1e-176 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62243186..62243304 119 N° 2 62242894..62243068 175 N° 3 62242728..62242793 66 N° 4 62241394..62241442 49
N° 5 62241165..62241250 86 N° 6 62240996..62241075 80 N° 7 62240736..62240838 103 N° 8 62240604..62240662 59
N° 9 62240513..62240528 16  
complement(join(62240513..62240528,62240604..62240662,62240736..62240838,6224099 6..62241075,62241165..62241250,62241394..62241442,62242728..62242793,62242894..6 2243068,62243186..62243304))


exon

Literature and cross-references SbAPx01 (Sobic.001G410200.1 [2.1] / Sb01g038760 [1.4])
DNA ref. Phytozome 12:   chromosome_1 (62243304..62240513)
Cluster/Prediction ref. UniGene:   Sbi.3729
Protein sequence: SbAPx01 (Sobic.001G410200.1 [2.1] / Sb01g038760 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27128.77  
PI (pH):   %s   5.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSYPTVSAEYSEAVEKARQKLRALIAEKSCAPLMLRLAWHSAGTFDVSSRTGGPFGTMKNPAELAHGANAGLDIAVRLLEPIKEEFPILSYADFYLAGVVAVEVTGGPQIPFHPGREDKPQPPPEGRLPDATKGSDHLRQVFGKQMGLSDQDIVALSGGHTGRCHKERSGFEGAWTSNPLVFDNSYFKELLSGDKEGLLQLPSDKALLSDPAFRPLVDKYADEKAFFEDYKEAHLKLSELGFADA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 8 introns) and 77 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAGCTACCCGACCGTGAGCGCCGAGTACAGCGAGGCCGTCGAGAAGGCCAGGCAAAAGCTCCGCGCCCTCATCGCCGAGAAGAGCTGCGCCCCACTCATGCTCCGCCTCGCG
TAAGCCTCCCTACCTCCACCTACCTCCCGTCCTCCCTGCGCGCGCATTTCTAGATCTTTGTGGGGGAGTTTTTTTTTTTCAGTCGCCTGATCTGGGTTTCCCGTTCGATCGCGCAGGTGG
CACTCCGCCGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCCTTCGGCACGATGAAGAACCCGGCGGAACTGGCGCATGGCGCCAACGCGGGGCTGGACATCGCGGTGCGGCTGCTC
GAGCCCATCAAGGAGGAGTTCCCCATCCTCTCTTACGCCGATTTCTACCAG
GTCGGTCCCCGATCTCGCATCGATCTGGTTCGATGATTCGATCTGCCCGAATGGATGTGCGTTCTGACC
GCGTACCTTTCTCTCTCTGCTCCTTTTGCAGCTCGCGGGAGTTGTGGCCGTGGAGGTCACTGGTGGGCCTCAGATCCCCTTCCACCCCGGTAGGGAGGTGAGATTTTTCAACCATTTGTT
AACTGTCTTTGGGGTTTAGCAGGGTTTAAGGTTTTGTTTAGAAATCTCCGAGGAGGTGGGTGTGAAGGTCGTTTAGTGAGATCGTGTTTGTTTACTCCAACTAGTACCATCGATCTATGT
GCGATTTATCACCTGTTTGGTAAATCCCTCGTGCAATTAGCTATAACCATTTATTCCTGGGATGCTACAATTAACCTTTATTTTGAGATTTGTGTCCACGCATCTTTCCGCTCTGTGGCT
CTGTCCCTGTGTGTTCATTGTTTCGGCTTGAAGTGGCCACTAGTTTAGGTTTTGATTAGTCTATAAATATCATCTTCGAATGGTGGGCCATTGTGCGCTAAAAATAATTTAGCGGTTTAC
TGTAGTGTTCGTCAAATATATGAGATGCAGCTTTCACTATGTGTATAGCTCAGTCCTTGTCTCTCATAGACGTGATAGGAGAGTCATATTAACTATATGCTTGTTTCATACTTTTTCCTA
TGATGAGAAAATGATGTCACTAATAACTTATCAAAACTTATGTTTAGAAGCTATTCCTAACACCAGTGGTTCTTTTGTGTTAGTTTTGTATAGGACAATGTCCATATAGCCTTCATTTTT
GAAAACTTATCGAAAAAATAATTGATCGTTTTATCATTTTGTATTGGTGTTCTCCATACATACTTATGTCACCCTGCCTGTTGGATTCTTGTCATCTTGCACATATATTGTGTTGAGTAG
GTAGGTCATGGTCATGTGATGAGGTATCATAGTGTTGCCAAACCAGTTTGCCCTTATCCTGTTATACATATATGTGTTGGCCAATACAATACCATATCATATGTCGTTATCTCTTTATTG
TGGAGGTCCACTTGTTGGGTCCTTGGATGCACAGTATGTTTGTTGTAAGTGTGCGTCTAGGCATTTCATGCCGTCTAGATAGTGTTGGTTGCCTTACCCTGATGGTGATGTGCACTATGC
ATATTATGCACCTATACGGTCCCTGTTGATATGCTGTCAAATTATACATGTATAGACCATAAACTTTCTGCATGTTGTCCAATGCTGATACTATTTTCCCTTGATTGTCATTACAATTTG
TTGGGTGACAATTATTTAACATTTGGTGTTAAAGTTGTTCAATTCTATCACTTATGTCTTGCTTTCTTAAAACTATAGCGATAGGCATGACTGACTGATATTATTTGTTCCATGCCTTTT
TCGCCGTCAGTATTTGTCACTGTAAAAACTTGAGTATTTACATCTTCCCTTGTCTTTTTCAGGACAAGCCTCAGCCCCCACCCGAGGGCCGTCTTCCTGATGCCACTAAGGGTAGATCTC
TAATCTTCACTACGATTGTCATGAATGCTGAATTGATTGGTTATATTCACCATGTATCCTTCAAGGCGTTGACGTCACTTTTATTGACATGATGACCGACTCTTATTCCTTGCTTGCTGT
TTTTTATTAACCAGGTTCTGACCACCTGAGGCAAGTCTTTGGCAAGCAGATGGGTCTGAGCGACCAGGACATTGTTGCCCTTTCTGGTGGCCACACCTTGGTTTGTTACTGCCCACTCAT
GTTTCCTTCAGAAATGTATGTAATATATGTATGCTTGAACTGATTTACTTTTATTTGAGGTTTTCTTAGGGAAGGTGCCACAAAGAGCGGTCTGGTTTTGAGGGGGCCTGGACTTCAAAC
CCTTTGGTCTTCGACAACTCTTACTTCAA
GTGAGTCTGTGTCATGTTTACTATGAAAAGCAACTGCATTTAGTTAAGAAATACTAAGAATTTATTTGCCTTTGTTATGTCTTTCCTGGGC
AGCTGTAAATACTATACTATACTAGAAATTAATAGCTATCCCATATATCCTGAACTTATTCTGTAGGGAACTTCTGAGTGGTGACAAGGAGGGCCTTCTTCAGCTCCCAAGTGACAAAGC
CCTGCTGAGCGACCCTGCCTTCCGCCCTCTTGTGGATAAATATGCTGCG
GTATGTCCGTCATTGTTTTCTAGGGTAAGGTGATCTGCAGGGAGATAAGTACTGATTATTGTGTGCCTTGT
AGGATGAGAAGGCATTCTTTGAAGACTACAAAGAAGCCCACCTCAAGCTCTCCGAACTGGGGTGAGTAACCAGTGATTGCACAATTTGTGCTTGGTCAGTGGGACAAATCTGATTGTTTA
CTCTCCTGGAATGCAGGTTCGCTGATGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAGCTACCCGACCGTGAGCGCCGAGTACAGCGAGGCCGTCGAGAAGGCCAGGCAAAAGCTCCGCGCCCTCATCGCCGAGAAGAGCTGCGCCCCACTCATGCTCCGCCTCGCG
TGGCACTCCGCCGGGACGTTCGACGTGTCGTCGAGGACCGGCGGTCCCTTCGGCACGATGAAGAACCCGGCGGAACTGGCGCATGGCGCCAACGCGGGGCTGGACATCGCGGTGCGGCTG
CTCGAGCCCATCAAGGAGGAGTTCCCCATCCTCTCTTACGCCGATTTCTACCAG
CTCGCGGGAGTTGTGGCCGTGGAGGTCACTGGTGGGCCTCAGATCCCCTTCCACCCCGGTAGGGAG
GACAAGCCTCAGCCCCCACCCGAGGGCCGTCTTCCTGATGCCACTAAGGGTTCTGACCACCTGAGGCAAGTCTTTGGCAAGCAGATGGGTCTGAGCGACCAGGACATTGTTGCCCTTTCT
GGTGGCCACACCTTG
GGAAGGTGCCACAAAGAGCGGTCTGGTTTTGAGGGGGCCTGGACTTCAAACCCTTTGGTCTTCGACAACTCTTACTTCAAGGAACTTCTGAGTGGTGACAAGGAG
GGCCTTCTTCAGCTCCCAAGTGACAAAGCCCTGCTGAGCGACCCTGCCTTCCGCCCTCTTGTGGATAAATATGCTGCG
GATGAGAAGGCATTCTTTGAAGACTACAAAGAAGCCCACCTC
AAGCTCTCCGAACTGGG
GTTCGCTGATGCTTAA

Retrieve as FASTA