Entry information : SbAPx08 (Sobic.004G175500.1[2.1] / Sb04g022560[1.4])
Entry ID 3503
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2011-01-21 (Toky Ramarohetra)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-09 (Catherine Mathe)
Peroxidase information: SbAPx08 (Sobic.004G175500.1[2.1] / Sb04g022560[1.4])
Name (synonym) SbAPx08 (Sobic.004G175500.1[2.1] / Sb04g022560[1.4])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation Thylakoid-bound
Tissue types Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx08
start..stop
S start..stop
ZmAPx08 808 0 1..454 1..451
SiAPx08 751 0 1..454 1..478
HvAPx07 696 0 1..454 1..446
TaAPx01-1A 691 0 20..454 23..431
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52120255..52120419 165 N° 2 52119999..52120127 129 N° 3 52119148..52119268 121 N° 4 52118966..52119066 101
N° 5 52118787..52118874 88 N° 6 52118592..52118659 68 N° 7 52118422..52118508 87 N° 8 52117880..52117954 75
N° 9 52117697..52117798 102 N° 10 52117511..52117615 105 N° 11 52116983..52117052 70 N° 12 52116636..52116736 101
N° 13 52116386..52116538 153  
complement(join(52116386..52116538,52116636..52116736,52116983..52117052,5211751 1..52117615,52117697..52117798,52117880..52117954,52118422..52118508,52118592..5 2118659,52118787..52118874,52118966..52119066,52119148..52119268,52119999..52120 127,52120255..52120419))


exon

Literature and cross-references SbAPx08 (Sobic.004G175500.1[2.1] / Sb04g022560[1.4])
DNA ref. Phytozome 11:   chromosome_4 (52120419..52116386)
Cluster/Prediction ref. UniGene:   Sbi.8377
Protein sequence: SbAPx08 (Sobic.004G175500.1[2.1] / Sb04g022560[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   454
PWM (Da):   %s   49211.62 Transmb domain:   %s   o434-453i
PI (pH):   %s   5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLAASLLPAASPSPSARRATVAAAAAASFPSPCSARAGLRLRSRQPLLSHSQKAAGRGRGVRVVRCMAASDAAQLKAAQEDIKELLKTTYCHPILVRLGWHDSGTYDKNIEEWPQRGGADGSLRFDAELSHGANAGLINALKLIQPIKDKYPGITYADLFQLASATAIEAGGPKIPMKYGRVDVTAAEQCPPEGRLPDAGPRDPAEHLREVFYRMGLDDEIVALSGAHTLGRSRPDRSGWGKPETKYTKDGPGEPGGQSWTVEWLKFDNSYFKDMKFLSQLPSEEQKEQDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSDLGSKFDPPEGFSLDDDMSTAPADEKTEEDISFEPVAAAITTATADDNNGAAPQPEPFVAAKYSYGRELSESMKQKIRAEYEGFGGSPDKPMQSNYFLNIMILIAGLAFLTSLVGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 11 introns) and 17 ESTs. Incorrect prediction from Phytozome (splicing errors confirmed with ESTs).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCGCCTCCCTCCTCCCCGCCGCCTCGCCGTCCCCGTCCGCCCGCCGCGCGACGGTCGCAGCCGCGGCCGCCGCCTCTTTCCCCTCCCCATGCTCCGCGCGCGCG
GGGCTGCGCCTACGCTCCCGCCAGCCCCTCCTCTCGCACTCGCAG
GTTCGCTTTTTATTCGCGCGCGCGCGCGACGGTGCATCATAGAGTTTGTCGGCCTACATTCTCGCTTACATCAGA
TCGAATCGAGCTGCTCTGACCTTGTAGTGGTGGCGGGGTTGCGTGCGCGCAGAAGGCGGCCGGGCGCGGGCGTGGCGTGCGGGTGGTCCGGTGCATGGCGGCGTCGGACGCGGCGCAGCT
CAAGGCCGCGCAGGAGGACATCAAGGAGCTCCTTAAGACCACATACTGCCACCCCATCCTG
GTACACAACAACACAGAGCGAACCTGTATATTTGAACTTGGTTAGATACAATGAGTGGC
GATGTTGCTTTTTGTTTCAATCCGGTTGTCCTGCACTCCTGCTGCTTGTGGTGTGCAGTGTGGTTATTGCACATGCCGTCAGATGTAGCATGGGTTCTCATTGCATCAGAGATGTCCATC
TCTGTAGTTGAGGGTTAGGTTGTTCTCAAGGAAAATAAAGGAACATTCCCTTGTGGTTTCTGATGATCAGGGGGCAATGAGTTCAGAGGGTTGATGCCAAACAATGCTGTAACTGCAGAA
TACGGCCAGATCACATGGGAATGTACCAAAACTTGAATGTAGCAATGATGAAATGCGCCAAGGGAGGACAACGACCGATGTTCCTATGGTACCCACAAGTCTCTGCTTTAGAAAACATCC
AACAACAAAGGCACAGATTTGGACGTTAGCACAAGTTTAATTGGTTGGATACGTGTGCTACGGCAAACATGTACATTGGAGGAGCTACCAAATTTCCACATTTTTCTGTCTCTGCAAATC
AGTGCTACTATATGACATTGTTCTTGTTTCCCTTGCATTTTACTGGGCTGATTAGTGGAAATTAGTTACATGCGGCATTGCACGGAATTGTTTACCAGTGCTTCTGCAATTGTACGCAGA
AGCAAGTTTACCATGTCCTCTGTAGTCGTATTGTGTTGTGTCAATAAGTGAATGCTTTCGACTCTGTTCAGGTCCGTCTGGGGTGGCATGATTCTGGTACCTATGACAAGAATATTGAGG
AGTGGCCACAACGAGGTGGAGCTGATGGAAGCTTAAGGTTCGATGCTGAGTTGAGTCATGGAGCCAATGCTG
GTATTTTCTATTTCTTGACAGTCTAAATTTCTTACATTCTAGGTCAGT
AGTAACTTGCAGATTTTGACTTGATTTTCACAGGTCTGATTAATGCATTGAAGCTTATCCAACCTATCAAGGACAAATACCCAGGTATCACTTATGCAGATTTGTTCCAGTTAGCGAGTG
CTACGGCAATTGAG
GTCATTGCCCTTTCTCTGCTTAAGTATCTCACTTGGTCATTTGATCAGTCAAGTCTATATAGTAATATGTTTGGTCAATCGCATAATACAGGAAGCTGGTGGCCCG
AAAATTCCAATGAAATATGGGCGGGTTGATGTCACAGCAGCTGAGCAGTGTCCACCTGAAGGGAGGCTTCCTG
GTCAGTGTTTCCAATGGGTTCTTCATTCCATACCAATGTCTCATTTT
TTGTTTTGGTCAGTGCTTGAAATGTGACTTATGAGAGGTACCTATCAAACTAAATTGTTGCTAATGCACATGTTCTGCAGACGCTGGCCCACGTGATCCGGCTGAACACCTTAGGGAGGT
ATTCTATAGAATGGGCCTTGATGACAAG
GTGTGGCGGGTTTTGAAACTTACTTAACTGTCTATCTGTATTTTCTTGAGCTATGTCATTGAACTTCCGGGGCATTTGTGCAGGAAATTGTT
GCACTATCTGGAGCACATACACTTGGAAGATCAAGGCCTGACCGGAGTGGCTGGGGAAAACCAGAAACAAAATATACC
GTATGTTTTTATGTTCTATTTGCTTCAGTTTAAATAAGAAAC
AATAGGTTATTTTCAATAATATGAAGCTTTTGGGCATGCTCGAACCGTACGCTATCCATTATTCTGTATTTTGAGTACAGAATAAACACTTTGCTATCATGTTGTGACTTAGAATTCCTG
GGATTCTTTGCCTTACAGTGGAGTTACTTGATAAGACTTGATAACTTCTATAGTCTGTCTCCTTTTGCTACGTTTAGTGACAGAACATAACCAAGACGCAAAAACTTACCTGATAGCCAG
TATTCTTGGTATTGTACTATTCTCCACCTGTTGATGTTTTTTTTTAATTGACAAATGGAACTTCTGTTCTTCTCACTTCTCATACCCAGACTATCTTCTTTGCAAACTTCATTACCAGGC
AGGTTGTGAAAATGGTTAGTTTCAATTAACCAGTACTGAGGTGTTCCTGTCATTGCATTTTGCAGAAGGATGGGCCTGGTGAGCCTGGAGGGCAATCATGGACAGTTGAGTGGTTGAAGT
TTGATAACAGTTACTTCAAG
GTGTGCTTCCTTTTTGTCGTGTTTATAGATCATATTATTCACGAGAATCTCTGATGATTTAATCTGTTAACAACGCTTCAGGACATGAAGTTTTTGAGCC
AACTTCCCTCGGAAGAGCAGAAGGAACAGGATCTTCTAGTTTTGCCCACAGATGCTGCATTATTTGAGGACCCATCATTCAAG
GTAGTGCTTGAGCTCAGCTTGCGACTTCTGTTCTTTT
TGAAGATCGTTCTTGCATTCACTGAGAATCTATGGCACATTCAGGTATACGCGGAAAAGTACGCAGAGGACCAGGAAGCGTTTTTCAAAGACTATGCTGAAGCTCATGCTAAGCTGAGCG
ATCTTGGTTCAAAGTTTGATCCTCCTGAG
GTTAGTGTTAGTGTGTTACAATCCTTCCATTTTGACCGTCTACAACCAGTCACAACTTTAGTAAATGAGTAAACACACTAGGACAATATGT
CAATATCTATTCTTGAGGTCTTCCATTTGAATGACTTATTTATCTCCTATAATGTGCATGCTCTTTGCTTCCTTATCGTATTCACTAGATCATGTTCGGTCATATGAGATGAAAGAAACA
TTAATGTGCCAGTACAGCAAGACCAGAATTTAGTCTGATAATGGGAGTTTGAGATGTATAGGACAAGTTGTAACTGGCAGTAAATTATTAGTCTGTCTTGAACCACTCCATAGAAACGTA
TGATTGATTTTTGTTAAAGCTGCTTGGGTCAACTTTTCCTTGTTCCCAGTTCTTGCAGAAACTTTATGTGTATGTTGGTTACAGACTTACAGTCTAACTGCATGCATGTGATGTGATTGC
CATGCAGGGATTCTCACTGGACGATGACATGAGCACTGCACCTGCAGACGAAAAGACGGAAGAAGATATCTCTTTTGGTGAGAGATTGAAACAATTTTTAGCAGGCATCTCTTGGAAAAA
CTTTCAAGTTCAAAACTTTTTAATTTTTCTTAAAAAGTTATGGACGGATTTGTTGAAACGAATTTCAACCGGTACCCCTTGGAAATGGGGTACTGCACTAACACTGGAACCATGGGGTAC
TGCACTAACACTGGAACCATCAGTAGCAGTGGCACCGTCACCAGTGGCTCCAGAACCTGAACCAGCAGCAGAACCTACACCAGAACCAGTAGCAGCGGCAATAACAACAGCGACAGCCGA
TGACAACAACGGCGCAGCTCCACAGCCGGAGCCCTTCGTCGCTGCCAAATACTCGTATGGAAAG
GTAAAAGCACTTACTTTGCTCCCTCCATTAAACTCTTACAATCTACTAGAGGACAG
CTCGACGGTAAACTGATGGAGCATGTCGCGGGTGAACTCAGAGGGAGCTGTCAGAGTCGATGAAGCAAAAGATCAGAGCAGAGTACGAGGGGTTCGGAGGCAGCCCGGACAAGCCCATGC
AGTCCAACTACTTCCTCAACATCATGATCCTGATCGCAGGGCTGGCGTTCTTGACGTCTCTGGTCGGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCGCCTCCCTCCTCCCCGCCGCCTCGCCGTCCCCGTCCGCCCGCCGCGCGACGGTCGCAGCCGCGGCCGCCGCCTCTTTCCCCTCCCCATGCTCCGCGCGCGCG
GGGCTGCGCCTACGCTCCCGCCAGCCCCTCCTCTCGCACTCGCAG
AAGGCGGCCGGGCGCGGGCGTGGCGTGCGGGTGGTCCGGTGCATGGCGGCGTCGGACGCGGCGCAGCTCAAGGCC
GCGCAGGAGGACATCAAGGAGCTCCTTAAGACCACATACTGCCACCCCATCCTG
GTCCGTCTGGGGTGGCATGATTCTGGTACCTATGACAAGAATATTGAGGAGTGGCCACAACGAGGT
GGAGCTGATGGAAGCTTAAGGTTCGATGCTGAGTTGAGTCATGGAGCCAATGCTG
GTCTGATTAATGCATTGAAGCTTATCCAACCTATCAAGGACAAATACCCAGGTATCACTTATGCA
GATTTGTTCCAGTTAGCGAGTGCTACGGCAATTGAG
GAAGCTGGTGGCCCGAAAATTCCAATGAAATATGGGCGGGTTGATGTCACAGCAGCTGAGCAGTGTCCACCTGAAGGGAGGCTT
CCTG
ACGCTGGCCCACGTGATCCGGCTGAACACCTTAGGGAGGTATTCTATAGAATGGGCCTTGATGACAAGGAAATTGTTGCACTATCTGGAGCACATACACTTGGAAGATCAAGGCCT
GACCGGAGTGGCTGGGGAAAACCAGAAACAAAATATACC
AAGGATGGGCCTGGTGAGCCTGGAGGGCAATCATGGACAGTTGAGTGGTTGAAGTTTGATAACAGTTACTTCAAGGACATG
AAGTTTTTGAGCCAACTTCCCTCGGAAGAGCAGAAGGAACAGGATCTTCTAGTTTTGCCCACAGATGCTGCATTATTTGAGGACCCATCATTCAAG
GTATACGCGGAAAAGTACGCAGAG
GACCAGGAAGCGTTTTTCAAAGACTATGCTGAAGCTCATGCTAAGCTGAGCGATCTTGGTTCAAAGTTTGATCCTCCTGAG
GGATTCTCACTGGACGATGACATGAGCACTGCACCTGCA
GACGAAAAGACGGAAGAAGATATCTCTTTTG
AACCAGTAGCAGCGGCAATAACAACAGCGACAGCCGATGACAACAACGGCGCAGCTCCACAGCCGGAGCCCTTCGTCGCTGCCAAATAC
TCGTATGGAAAG
AGGGAGCTGTCAGAGTCGATGAAGCAAAAGATCAGAGCAGAGTACGAGGGGTTCGGAGGCAGCCCGGACAAGCCCATGCAGTCCAACTACTTCCTCAACATCATGATC
CTGATCGCAGGGCTGGCGTTCTTGACGTCTCTGGTCGGGAACTGA

Retrieve as FASTA