Entry information : MtAPx01 (Medtr4g061140.1[4.0] / Medtr4g061140.1[3.5] )
Entry ID 3509
Creation 2006-08-16 (Christophe Dunand)
Last sequence changes 2006-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-30 (Christophe Dunand)
Peroxidase information: MtAPx01 (Medtr4g061140.1[4.0] / Medtr4g061140.1[3.5] )
Name (synonym) MtAPx01 (Medtr4g061140.1[4.0] / Medtr4g061140.1[3.5] )
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtAPx01
start..stop
S start..stop
PsAPx01 491 3e-179 1..250 1..250
GmAPx01 486 1e-177 1..250 1..250
VuAPx01 485 6e-177 1..250 1..250
GmAPx26 477 8e-174 1..246 1..246
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22583197..22583315 119 N° 2 22582730..22582904 175 N° 3 22582564..22582629 66 N° 4 22581910..22581958 49
N° 5 22581737..22581822 86 N° 6 22581378..22581457 80 N° 7 22581179..22581281 103 N° 8 22580999..22581057 59
N° 9 22580870..22580885 16  
complement(join(22580870..22580885,22580999..22581057,22581179..22581281,2258137 8..22581457,22581737..22581822,22581910..22581958,22582564..22582629,22582730..2 2582904,22583197..22583315))


exon

Literature and cross-references MtAPx01 (Medtr4g061140.1[4.0] / Medtr4g061140.1[3.5] )
Literature Shaull,S., Lin,S., Dixon,R., May,G., Sumner,L., Gonzales,B.,
Cook,D., Kim,D. and Roe,B.A. Direct Submission
DNA ref. Phytozome 11:   chr4 (22583315..22580870)
Cluster/Prediction ref. Phytozome Gene 11:   31111925 UniGene:   Mtr.6412
Protein sequence: MtAPx01 (Medtr4g061140.1[4.0] / Medtr4g061140.1[3.5] )
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27035.77  
PI (pH):   %s   5.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSADYQKAVEKAKRKLRGFIAEKKCAPLMLRLAWHSAGTFDSKTKTGGPFGTIKHQAELAHGANNGLDIAVRLLEPLKEQFPIISYADFYLAGVVAVEVTGGPEVPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGKAMGLSDQDIVALSGGHTGAAHKERSGFEGPWTSNPLIFDNSYFTELLGGEKEGLLQLPSDKALLSDPVFRPLVEKYADEDAFFADYAEAHQKLSELGFAEA

Retrieve as FASTA  
Remarks Complete sequence from 435 ESTs and genomic (chromo 4, 8 introns). Also found in AC137668 and DQ122791 (fragment).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAATCTTACCCAACCGTGAGTGCTGATTACCAGAAGGCTGTTGAGAAGGCGAAGAGGAAGCTCAGAGGTTTCATCGCTGAGAAGAAATGTGCTCCTCTTATGCTCCGTTTGGCG
TAAGTTTCATTTTCCGCTCATTTTTTGTAGGACCGTTTCTATGTGAGATTTTCACTTATTAGATTGTTTAGCTTAAATTTGTGCTTGATTATTTTTTTGTAATTATTCGTGTGATTTTTG
TCATGATTTGTGTAATTTTATTTTTGTTATGATTTGTTTTGACTTTTTTGTCACAATTTTTTTTTGTTTGATGATTTGTGATGAATTGTATGATTTTTTTTGTAATCAACTGAGTGTTTT
CTTTTTATGATGAATTGAGTGTGATTTTTTTGTTATGATTTGTTTGTGTAGATGGCACTCTGCTGGAACTTTTGATTCAAAGACAAAGACTGGTGGTCCTTTCGGAACCATCAAGCACCA
AGCCGAGCTTGCTCATGGTGCTAACAACGGTCTTGATATTGCTGTTAGGCTTTTGGAGCCTCTTAAGGAGCAATTCCCAATCATTAGCTATGCTGATTTCTACCAG
GTAGTGATTTGTTG
TATTTTTTGTGATGAATTGCTAGATCTTGCTGTATTATTTCAGTCTACGATTTTTGTGCTTAATGGCTTGCTTTGTGGTTATGCAGTTGGCTGGTGTTGTTGCTGTTGAGGTTACAGGTG
GACCTGAAGTTCCTTTCCACCCAGGCAGGGAG
GTATGTTTATGTTTAGTACTTTCAGTTTCTCTTTATTTATTTATATGGTATAGTTGTATTTTTTCAATACAAATTATGATACTTCTTT
AACTTTTTGGTCGTATTTTTTGTCTGCAAATCTTGTTGACATGATTTGAAAATCAATTACTGGTTATAACTTTTCTCGGTATATAATGATCGGAATTATGTCCGCGAATACTTTTTTTGT
AAAGTGTTTGATCAGTCTTTGTAACATGTATGGGAATTATTTGTAAGTTTTGACTGTCTGTTCGAAATGCGTTTGCAATTAATACGAAACAAATTTGTCTTGCATTTCACGTTCTCAGAT
TTCATTTATTTGCATGTTATGTAAGCTGTCTGTAATCCTTATCAACGAGTTTCTGGGTTTCAAATATTTCTGTTGGTAACCAACTTGTAGATTGCATTGCAATAATTAACCACATGTGAT
AACTGGGAATGCTTTTTGTCTCTTGCATGTTTTGTAATTATGTACACATATGGATGCTAAATTATACTCAAAAGATGCTGATGTATCTTTGTTTTTCACCCTATTTAATTTTTATATTTG
GAGGCTAATTGGTCCTTTGTTCTGGTTTAATTATCAGGACAAGCCTGAGCCACCACCAGAGGGTCGCTTGCCTGATGCCACCAAGGGTAAGTGTTCTGGACTTGCGATGTGAATTATTGC
CTACAATTGACTGGTAGTTGTTTGGCTCATTATTTGATTCTTGATTTTTGCAGGTTCTGACCATTTGAGGGATGTGTTTGGCAAAGCTATGGGGCTTAGTGACCAGGACATCGTTGCTTT
GTCTGGTGGCCACACCATT
GTATGCATTGACTTTAATCTGTTTATTGAGTATAGTATTTGTCACATTTGATATTTTGACACTGGAATAAGCATCTAAGTTTTGTGGCTGCATTGTGGTTG
TGCGATTTGTGATTGTGATGATATGGCTGCCAATGCAAAAAACTTGACTAAGTTGCCTTATTATCTGCAAAATTTTATTTTTAACTTGTTTAATTGTTATGAAAAATAATAACATATTCG
ACTATTCTCAACATTGAGGTTGTGACTGTGTTTTGGTTATGCTTAATGTAATTTTTAGGGAGCTGCACACAAGGAGCGTTCTGGATTTGAGGGCCCATGGACTTCTAATCCTCTCATTTT
TGACAACTCATACTTTAC
GTGAGTCTAATTAAAAACATTATCTCTCATCCATGCCCCCTTTTTTCTTTGTTTTAAATTCTTATTATTGATTATCGATGTTGTTGGAATGATTAGGGAGTT
GTTGGGTGGTGAGAAGGAAGGCCTTCTTCAGTTGCCAAGTGATAAGGCACTTTTGAGCGACCCTGTATTCCGCCCACTTGTTGAGAAATATGCTGCT
GTATGTATATTTAATATTTAATA
TTCCTATAATAATCCTTTTCATCATATTGTTGGCATTATGAAATTATTATATCTGCTGATAAGTTAATCTAAGAATTCTCATTTGTCAATGATTGCAGGATGAAGATGCTTTCTTTGCTG
ATTATGCCGAAGCTCATCAGAAGCTATCTGAGCTTGG
GTAAGTCATATAATATATCTTGTATTTATCTTCAAAGATTACGATTTTACACATCCTTTAAGTTCTGCATTATCCATTGGAAG
TTGATTCATGTTATGTTTTTTACCTCATAGGTTCGCAGAAGCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAATCTTACCCAACCGTGAGTGCTGATTACCAGAAGGCTGTTGAGAAGGCGAAGAGGAAGCTCAGAGGTTTCATCGCTGAGAAGAAATGTGCTCCTCTTATGCTCCGTTTGGCA
TGGCACTCTGCTGGAACTTTTGATTCAAAGACAAAGACTGGTGGTCCTTTCGGAACCATCAAGCACCAAGCCGAGCTTGCTCATGGTGCTAACAACGGTCTTGATATTGCTGTTAGGCTT
TTGGAGCCTCTTAAGGAGCAATTCCCAATCATTAGCTATGCTGATTTCTACCAG
TTGGCTGGTGTTGTTGCTGTTGAGGTTACAGGTGGACCTGAAGTTCCTTTCCACCCAGGCAGGGAG
GACAAGCCTGAGCCACCACCAGAGGGTCGCTTGCCTGATGCCACCAAGGGTTCTGACCATTTGAGGGATGTGTTTGGCAAAGCTATGGGGCTTAGTGACCAGGACATCGTTGCTTTGTCT
GGTGGCCACACCATT
GGAGCTGCACACAAGGAGCGTTCTGGATTTGAGGGCCCATGGACTTCTAATCCTCTCATTTTTGACAACTCATACTTTACGGAGTTGTTGGGTGGTGAGAAGGAA
GGCCTTCTTCAGTTGCCAAGTGATAAGGCACTTTTGAGCGACCCTGTATTCCGCCCACTTGTTGAGAAATATGCTGCT
GATGAAGATGCTTTCTTTGCTGATTATGCCGAAGCTCATCAG
AAGCTATCTGAGCTTGG
GTTCGCAGAAGCCTAA

Retrieve as FASTA