Entry information : MtPrx25 (Medtr8g076820.1[4.0] / Medtr8g076820.1[3.5] / Medtr8g092750.1[3.0])
Entry ID 351
Creation 2006-06-21 (Christophe Dunand)
Last sequence changes 2010-09-16 (Haythem Mhadhbi)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx25 (Medtr8g076820.1[4.0] / Medtr8g076820.1[3.5] / Medtr8g092750.1[3.0])
Name (synonym) MtPrx25 (Medtr8g076820.1[4.0] / Medtr8g076820.1[3.5] / Medtr8g092750.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Arbuscular mycorrhiza (inoculated root)
Roots
Roots nodules
Seedling roots
Inducers Glomus intraradices infection
Glomus versiforme infection
Nitric Oxide (NO)
Nodulation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx25
start..stop
S start..stop
GmPrx33 572 0 1..330 1..330
RcPrx17 569 0 1..330 1..330
MePrx01 567 0 1..331 1..331
CpapPrx44 562 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32581677..32581901 225 N° 2 32581268..32581459 192 N° 3 32580862..32581027 166 N° 4 32580330..32580745 416
complement(join(32580330..32580745,32580862..32581027,32581268..32581459,3258167 7..32581901))


exon

Literature and cross-references MtPrx25 (Medtr8g076820.1[4.0] / Medtr8g076820.1[3.5] / Medtr8g092750.1[3.0])
Literature REFERENCE 1 Journet,E.P. et al., unpublished, Harrison,M.J. et al., unpublished.
REERENCE 2 Ferrarini A, De Stefano M, Baudouin E, Pucciariello C, Polverari A, Puppo A, Delledonne M.Expression of Medicago truncatula genes responsive to nitric oxide in pathogenic and symbiotic conditions. MPMI. 2008 Jun;21(6):781-90.
Protein ref. UniProtKB:   Q1T1B3
DNA ref. Phytozome 11:   chr8 (32581901..32580330)
Cluster/Prediction ref. Phytozome Gene 11:   31074744 UniGene:   Mtr.7592
Omic ref. Gene atlas:   Mtr.15484.1.S1_at Legoo:   Mtr.15484.1.S1_at
Protein sequence: MtPrx25 (Medtr8g076820.1[4.0] / Medtr8g076820.1[3.5] / Medtr8g092750.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (310)
PWM (Da):   %s   36653.55 (34267.4)  
PI (pH):   %s   8.39 (8.54) Peptide Signal:   %s   cut: 23 range:23-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANSLSFLMLLSLLAFAPFCLCHKKMGSYLYPQFYDYSCPQAQNIVKSILANAVAKEPRIAASLLRLHFHDCFVKGCDASILLDNSGSIISEKGSNPNRNSARGFEVIDEIKYALEKECPHTVSCADILAIAARDSTVLAGGPNWEVPLGRRDSLGASLSGSNNNIPAPNNTFQTILTKFKLQGLDIVDLVALSGSHTIGKSRCTSFRQRLYNQTGNGKQDFTLDQYYAAELRTQCPRSGGDQNLFFLDYVTPTKFDNNYFKNLLAYKGLLSSDEILLTKNQESAELVKLYAERNDLFFEQFAKSMIKMGNISPLTGSRGNIRTNCRVINTW

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 8, 3 introns) and 10 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTTTGAGCTTTCTCATGCTTCTTTCTTTACTAGCATTTGCTCCTTTTTGCCTCTGTCATAAGAAAATGGGGTCTTACCTTTATCCACAATTTTATGACTATTCATGTCCA
CAAGCTCAGAATATTGTTAAGTCCATCCTTGCCAATGCTGTTGCAAAGGAACCCCGTATAGCTGCTTCACTTTTGAGACTTCATTTCCATGACTGTTTTGTCAAG
GTATGTGATATTATC
ATTATTGTCATGACCATGTGATATTAAGTCGTGGCCGTGCCAAAAACTTTGATGTTGCGGTGATTAAAAATGCATTATATGTATGTAGCCTCGACACTTCAAATTGAAGACGCATCCAAC
ATGTGTCGGTGTCAGATACCAACATATATGATTACATTCAATCATGTCTATTTTTTATACTAAGAAGTTGATCATGTTGCAGGGTTGTGATGCTTCAATATTGTTAGATAACAGTGGAAG
CATTATTAGTGAGAAGGGTTCAAATCCGAACCGTAATTCAGCTAGAGGATTCGAGGTCATTGATGAAATTAAATATGCACTAGAGAAAGAATGTCCTCATACAGTTTCTTGTGCTGACAT
TTTGGCTATAGCTGCTAGAGATTCAACTGTTCTT
GTAAGTATTTATTTAATTTGCTATTGCTTTTTCTAGTAAAAAAATTTCACTATAGAAACAAAATATGACATGTCCATAAATTGTGT
TTCGTATATTTTCATAAGCGCTATTTTATCTTTTGTTATAGATGCAGCTTATACATAAGTACTTGTATGATAAGCGTTTATGCTATAAACATTTTAATTTAGTTGAAGACTTATATAGTT
ACATTCTTACATTACTATTCCCTTTTATGTGTAGGCTGGTGGACCAAACTGGGAAGTGCCTCTAGGCAGAAGAGACTCACTAGGTGCAAGTTTAAGTGGTTCCAACAACAACATTCCAGC
CCCAAACAACACATTCCAGACAATCCTAACTAAATTCAAACTTCAAGGACTTGACATTGTTGATCTTGTTGCTCTTTCTG
GTTCACTCCTTGAACTTGTGACATAAATTTAAATTATTTT
ATTTTGAATATAGTTCATATGTTTATATCACACTATACATAACAACATGCTGAAACAAATCTTATGCAATTGGTAGGGAGTCACACTATAGGAAAGTCAAGGTGCACAAGCTTTAGGCAA
AGACTCTACAACCAAACTGGAAATGGCAAGCAAGATTTCACTCTTGATCAATACTATGCTGCTGAATTGCGCACTCAATGTCCAAGATCTGGTGGTGACCAAAATCTGTTCTTCCTAGAC
TATGTCACACCGACAAAATTTGATAACAATTACTTCAAGAACCTATTGGCTTACAAGGGACTATTGAGCTCTGATGAAATTCTGTTGACAAAGAATCAAGAATCAGCTGAGTTGGTGAAA
TTGTATGCTGAGAGAAATGATCTTTTCTTTGAGCAATTTGCTAAGTCTATGATCAAGATGGGAAATATATCTCCTTTGACAGGTTCAAGAGGAAACATTAGAACAAATTGCAGGGTGATT
AATACTTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAATTCTTTGAGCTTTCTCATGCTTCTTTCTTTACTAGCATTTGCTCCTTTTTGCCTCTGTCATAAGAAAATGGGGTCTTACCTTTATCCACAATTTTATGACTATTCATGTCCA
CAAGCTCAGAATATTGTTAAGTCCATCCTTGCCAATGCTGTTGCAAAGGAACCCCGTATAGCTGCTTCACTTTTGAGACTTCATTTCCATGACTGTTTTGTCAAG
GGTTGTGATGCTTCA
ATATTGTTAGATAACAGTGGAAGCATTATTAGTGAGAAGGGTTCAAATCCGAACCGTAATTCAGCTAGAGGATTCGAGGTCATTGATGAAATTAAATATGCACTAGAGAAAGAATGTCCT
CATACAGTTTCTTGTGCTGACATTTTGGCTATAGCTGCTAGAGATTCAACTGTTCTT
GCTGGTGGACCAAACTGGGAAGTGCCTCTAGGCAGAAGAGACTCACTAGGTGCAAGTTTAAGT
GGTTCCAACAACAACATTCCAGCCCCAAACAACACATTCCAGACAATCCTAACTAAATTCAAACTTCAAGGACTTGACATTGTTGATCTTGTTGCTCTTTCTG
GGAGTCACACTATAGGA
AAGTCAAGGTGCACAAGCTTTAGGCAAAGACTCTACAACCAAACTGGAAATGGCAAGCAAGATTTCACTCTTGATCAATACTATGCTGCTGAATTGCGCACTCAATGTCCAAGATCTGGT
GGTGACCAAAATCTGTTCTTCCTAGACTATGTCACACCGACAAAATTTGATAACAATTACTTCAAGAACCTATTGGCTTACAAGGGACTATTGAGCTCTGATGAAATTCTGTTGACAAAG
AATCAAGAATCAGCTGAGTTGGTGAAATTGTATGCTGAGAGAAATGATCTTTTCTTTGAGCAATTTGCTAAGTCTATGATCAAGATGGGAAATATATCTCCTTTGACAGGTTCAAGAGGA
AACATTAGAACAAATTGCAGGGTGATTAATACTTGGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCACCAGCTT TCTCTGAGTG ATATTGAAAA AAGAACAATG GCAAATTCTT TGAGCTTTCT CATGCTTCTT TCTTTACTAG CATTTGCTCC TTTTTGCCTC TGTCATAAGA AAATGGGGTC  TTACCTTTAT CCACAATTTT ATGACTATTC ATGTCCACAA GCTCAGAATA TTGTTAAGTC CATCCTTGCC AATGCTGTTG CAAAGGAACC CCGTATAGCT GCTTCACTTT TGAGACTTCA  TTTCCATGAC TGTTTTGTCA AGGGTTGTGA TGCTTCAATA TTGTTAGATA ACAGTGGAAG CATTATTAGT GAGAAGGGTT CAAATCCGAA CCGTAATTCA GCTAGAGGAT TCGAGGTCAT  TGATGAAATT AAATATGCAC TAGAGAAAGA ATGTCCTCAT ACAGTTTCTT GTGCTGACAT TTTGGCTATA GCTGCTAGAG ATTCAACTGT TCTTGCTGGT GGACCAAACT GGGAAGTGCC  TCTAGGCAGA AGAGACTCAC TAGGTGCAAG TTTAAGTGGT TCCAACAACA ACATTCCAGC CCCAAACAAC ACATTCCAGA CAATCCTAAC TAAATTCAAA CTTCAAGGAC TTGACATTGT  TGATCTTGTT GCTCTTTCTG GGAGTCACAC TATAGGAAAG TCAAGGTGCA CAAGCTTTAG GCAAAGACTC TACAACCAAA CTGGAAATGG CAAGCAAGAT TTCACTCTTG ATCAATACTA  TGCTGCTGAA TTGCGCACTC AATGTCCAAG ATCTGGTGGT GACCAAAATC TGTTCTTCCT AGACTATGTC ACACCGACAA AATTTGATAA CAATTACTTC AAGAACCTAT TGGCTTACAA  GGGACTATTG AGCTCTGATG AAATTCTGTT GACAAAGAAT CAAGAATCAG CTGAGTTGGT GAAATTGTAT GCTGAGAGAA ATGATCTTTT CTTTGAGCAA TTTGCTAAGT CTATGATCAA  GATGGGAAAT ATATCTCCTT TGACAGGTTC AAGAGGAAAC ATTAGAACAA ATTGCAGGGT GATTAATACT TGGTGATCAA GCAATATATC ATTGCTTTAT ACAAATCATA CATGAAAATT  GCATATGAAT TATATTTTTA TGTTTACTTT TTTCCCTTGG TGAGTTGATT ATCTTGAATC CATTGCTAGT GTGTCCACTT TGGGCATTTT GGCTTTGGAT AGTATTCTTG TGTGTCTCAT 
GAAATTATTG TACTTAAGTT GTCCATATCT TTTATAAAGA AGTGATTGTT CTTCCTTAAT CC 

Retrieve as FASTA