Entry information : MtPrx28 (Medtr2g084020.1[4.0] / Medtr2g084020.1[3.5] / Medtr2g098060.1[3.0])
Entry ID 353
Creation 2005-06-16 (Christophe Dunand)
Last sequence changes 2010-09-16 (Haythem Mhadhbi)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtPrx28 (Medtr2g084020.1[4.0] / Medtr2g084020.1[3.5] / Medtr2g098060.1[3.0])
Name (synonym) MtPrx28 (Medtr2g084020.1[4.0] / Medtr2g084020.1[3.5] / Medtr2g098060.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Cell culture
Roots
Inducer Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx28
start..stop
S start..stop
MtPrx43 596 0 1..318 1..318
PsPrx11 590 0 1..318 1..318
MtPrx57 549 0 1..318 1..317
MtPrx97 548 0 1..318 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35290936..35291145 210 N° 2 35290658..35290849 192 N° 3 35289292..35289846 555  
complement(join(35289292..35289846,35290658..35290849,35290936..35291145))


exon

Literature and cross-references MtPrx28 (Medtr2g084020.1[4.0] / Medtr2g084020.1[3.5] / Medtr2g098060.1[3.0])
Literature Torres-Jerez,I. et al., unpublished
DNA ref. Phytozome 11:   chr2 (35291145..35289292)
EST ref. GenBank:   BF520475
Cluster/Prediction ref. Phytozome Gene 11:   31066518
Omic ref. Gene atlas:   Mtr.11354.1.S1_at   Mtr.45378.1.S1_at
Protein sequence: MtPrx28 (Medtr2g084020.1[4.0] / Medtr2g084020.1[3.5] / Medtr2g098060.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (295)
PWM (Da):   %s   34080.22 (31640.9)  
PI (pH):   %s   8.49 (8.39) Peptide Signal:   %s   cut: 24 range:24-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATLNKLFVTLSIFSLLACSTNAQLVNNFYGTTCPSLQTIVRREMTKAINNEARIGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKNAGPNKNSARGFEVIDAIKTSVEAACSATVSCADILALATRDGIALLGGPSWVVPLGRRDARTASQSAANSQIPGPSSDLSTLTTMFRNKGLTLNDLTVLSGAHTIGQAECQFFRTRIYNETNIDTNFATLRKSNCPTSGGDINLAPLDSVSPVTFDNNYYNDLVANKGLLHSDQALFNGVGSQVSLVRTYSRNNIAFKRDFAAAMVKMSRISPLTGTNGEIRKNCRLVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 2 introns) and 4 ESTs (BF520475, BF644020, BF650207 and AL368930). ESTs are incorrectly compiled in the UniGene Mtr.9089 and TC89194 TIGR. The ESTs correspond to MtPrx28 and MtPrx43.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACCTTAAACAAACTATTTGTTACACTCTCTATTTTTTCTCTCTTAGCTTGTTCTACCAATGCACAACTTGTTAATAACTTCTATGGTACAACTTGCCCTAGCCTTCAAACCATT
GTGCGCAGGGAAATGACCAAAGCTATCAATAATGAAGCTCGAATTGGTGCTTCTATACTTCGTTTGTTCTTCCATGATTGCTTTGTAAAT
GTAAGTCCACTTTAAGATAATGTTGAAAAA
TAATTTGTTTATTTGCATTAGACATTAACATGTCAATTTATTTGCTAATTTTGTAGGGATGTGATGGATCAATCTTATTGGATGACACTTCCACATTTACCGGTGAGAAAAATGCTGGAC
CTAACAAAAATTCAGCTAGGGGTTTTGAAGTGATTGATGCAATTAAAACTAGTGTTGAAGCTGCTTGCAGTGCCACTGTCTCTTGTGCTGATATTCTTGCACTTGCAACTAGAGATGGAA
TTGCTCTG
GTTAGTCACCCATTTCTTTCTTCATTTTTCTTTAAGAGTTTTGTTTTATTTTTTATTTCTATAAGTGTTTGGTATGGGACTTGTTTTCAAACCATGTCCCCCAAACCTCTTT
TAACCTTTTCTCACATATTTTAGATCGTCATCGTGTCAACTCTTGTTATTTTATGGGACCCTCAAGATAAAATAGATATTTTGGACAATGATGCATCACATAATACAACATGATCAAATT
ATATATGAAAAAAAAAAAAAAAACAGAAGTATCACAATATACAACCAGTCTTTTGTCAACCATGTCTCTTTATCAAAGATCGCAGTCAAATCACTCATTATACTAAAAAGGAAATTATCT
AAACGGTTTTATTATTATAAGATGAAAGGTGACACTTATTTAAACTTTAGTCCGATCTTATTTTATTTGACTTGACTTTTTTTTTCTCAATACAATTAATGCCTCATGTTTAACACTATT
ATATTGAGTTTAATTCATTTGTGTAAAAGCAGTTTATAAGATGATGGACGTCACTGTTTATAACTCTAATCAAATTTTATCTTTATTATATGCAAGACTTGAGTGTTTTTAATAAATTTC
TCTAATTATATGATTAAATTTAATGATGAGAGAATTAGATGAATTTTATTTATTTTCTCTAAATTTAATTGCTAATTCTATTTTTTAGTTATATATATCCATTCCAAAAAAGCAAGTACA
AAATACAAATACCAAATATAAACTATAGTCTTATGGTGCTTTATACTAGTTTTGATTCATCATGACTTTCTTAATCTCAATAATTAATTTATTTTGTAGCTTGGAGGTCCTTCATGGGTA
GTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGTCAAAGTGCAGCAAATAGCCAAATTCCAGGACCATCTTCTGACCTATCCACACTCACTACCATGTTTAGAAACAAAGGTCTAACA
TTAAATGACCTTACTGTCCTTTCTGGTGCACACACCATAGGTCAAGCAGAATGTCAATTTTTCAGAACTCGTATATACAACGAAACCAACATTGACACAAACTTTGCAACCTTAAGAAAA
TCAAATTGTCCTACTTCTGGTGGTGACATAAATTTGGCACCTCTTGATTCTGTCTCTCCAGTTACTTTTGACAACAATTACTATAATGACCTTGTTGCTAATAAAGGACTTCTTCATTCT
GATCAAGCTCTTTTCAATGGTGTTGGTTCTCAAGTTTCTTTGGTTAGGACTTATAGTAGAAATAATATTGCTTTTAAAAGAGACTTTGCAGCTGCTATGGTGAAGATGAGTAGAATTAGT
CCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGCAGGCTTGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACCTTAAACAAACTATTTGTTACACTCTCTATTTTTTCTCTCTTAGCTTGTTCTACCAATGCACAACTTGTTAATAACTTCTATGGTACAACTTGCCCTAGCCTTCAAACCATT
GTGCGCAGGGAAATGACCAAAGCTATCAATAATGAAGCTCGAATTGGTGCTTCTATACTTCGTTTGTTCTTCCATGATTGCTTTGTAAAT
GGATGTGATGGATCAATCTTATTGGATGAC
ACTTCCACATTTACCGGTGAGAAAAATGCTGGACCTAACAAAAATTCAGCTAGGGGTTTTGAAGTGATTGATGCAATTAAAACTAGTGTTGAAGCTGCTTGCAGTGCCACTGTCTCTTGT
GCTGATATTCTTGCACTTGCAACTAGAGATGGAATTGCTCTG
CTTGGAGGTCCTTCATGGGTAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGTCAAAGTGCAGCAAATAGCCAA
ATTCCAGGACCATCTTCTGACCTATCCACACTCACTACCATGTTTAGAAACAAAGGTCTAACATTAAATGACCTTACTGTCCTTTCTGGTGCACACACCATAGGTCAAGCAGAATGTCAA
TTTTTCAGAACTCGTATATACAACGAAACCAACATTGACACAAACTTTGCAACCTTAAGAAAATCAAATTGTCCTACTTCTGGTGGTGACATAAATTTGGCACCTCTTGATTCTGTCTCT
CCAGTTACTTTTGACAACAATTACTATAATGACCTTGTTGCTAATAAAGGACTTCTTCATTCTGATCAAGCTCTTTTCAATGGTGTTGGTTCTCAAGTTTCTTTGGTTAGGACTTATAGT
AGAAATAATATTGCTTTTAAAAGAGACTTTGCAGCTGCTATGGTGAAGATGAGTAGAATTAGTCCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGCAGGCTTGTGAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTAAATCAAA ATAGATAATT TTATATTGAA TGGCGACCTT AAACAAACTA TTTGTTACAC TCTCTATTTT TTCTCTCTTA GCTTGTTCTA CCAATGCACA ACTTGTTAAT AACTTCTATG  GTACAACTTG CCCTAGCCTT CAAACCATTG TGCGCAGGGA AATGACCAAA GCTATCAATA ATGAAGCTCG AATTGGTGCT ACTATACTTC GTTTGTTCTT CCATGATTGC TTTGTAAATG  GATGTGATGG ATCAATCTTA TTGGATGACA CTTCCACATT TACCGGTGAG AAAAATGCTG GACCTAACAA AAATTCAGCT AGGGGTTTTG AAGTGATTGA TGCAATTAAA ACTAGTGTTG  AAGCTGCTTG CAGTGCCACT GTCTCTTGTG CTGATATTCT TGCACTTGCA ACTAGAGATG GAATTGCTCT GCTTGGAGGT CCTTCATGGG TAGTACCACT TGGAAGAAGA GATGCAAGAA  CAGCAAGTCA AAGTGCAGCA AATAGCCAAA TTCCAGGACC ATCTTCTGAC CTATCCACAC TCACTACCAT GTTTAGAAAC AAAGGTCTAA CATTAAATGA CCTTACTGTC CTTTCTGGTG  CACACACCAT AGGTCAAGCA GAATGTCAAT TTTTCAGAAC TCGTATATAC AACGAAACCA ACATTGACAC AAACTTTGCA ACCTTAAGAA AATCAAATTG TCCTACTTCT GGTGGTGACA  TAAATTTGGC ACCTCTTGAT TCTGTCTCTC CAGTTACTTT TGACAACAAT TACTATAATG ACCTTGTTGC TAATAAAGGA CTTCTTCATT CTGATCAAGC TCTTTTCAAT GGTGTTGGTT  CTCAAGTTTC TTTGGTTAGG ACTTATAGTA GAAATAATAT TGCTTTTAAA AGAGACTTTG CAGCTGCTAT GGTGAAGATG AGTAGAATTA GTCCTCTAAC TGGGACTAAT GGGGAGATTA  GAAAGAATTG CAGGCTTGTG AACTAATTGA TTAATTAGAT AATCAAAGTC ATAAAGGTTG ACTAGATCTT GGACACATTG GCAATTGTAG TATTGTTGAT GCTACTTTAA TTTGATAGTT 
TCAATGTTTG TAGTTCCACA AATATATATG TTGTTTGTCT TACTTAAATC AATGAATGGA AAATGCTAGT TTTGTGTTGG ATTCAAAAAA AAAAAAAAAA A 

Retrieve as FASTA