Entry information : ZmPrx86 (peroxidase H)
Entry ID 36
Creation 2006-08-29 (Christophe Dunand)
Last sequence changes 2006-08-29
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx86 (peroxidase H)
Name (synonym) ZmPrx86 (peroxidase H)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducers Cyst nematode infection
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx86
start..stop
S start..stop
SbPrx06 560 0 5..331 4..326
SiPrx159 530 0 8..331 7..326
ZmPrx11 525 0 4..331 7..328
OsPrx126 495 2e-178 1..331 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32036110..32036331 222 N° 2 32036449..32036631 183 N° 3 32036743..32036908 166 N° 4 32037015..32037439 425
join(32036110..32036331,32036449..32036631,32036743..32036908,32037015..32037439 )


exon

Literature and cross-references ZmPrx86 (peroxidase H)
Literature Padegimas,L.S. and Reichert,N.A., Isolation of genes and regulatory sequences implicated in hypersensitive response from Zea mays nematode-resistant line MP307. Submitted (DEC-1997) to the EMBL/GenBank/DDBJ databases
Protein ref. UniProtKB:   Q9ZTS8   Q7G1F6 [Fragment]
DNA ref. GenBank:   AC233949.1 (34254..35580)
mRNA ref. GenBank:   AF037033
Cluster/Prediction ref. UniGene:   Zm.404
Protein sequence: ZmPrx86 (peroxidase H)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (310)
PWM (Da):   %s   35371.99 (33000.9)  
PI (pH):   %s   4.16 (4.10) Peptide Signal:   %s   cut: 28 range:22-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MERYSCCRWVLACSILALCLGGQGARCQLTSDFYDSTCPQLYYVVQQHVFDAMREEMRMGASLLRLHFHDCFVNGCDASILLDGDDGEKFALPNLNSVRGYEVIDAIKADLESACPEVVSCADVVALAASYGVLFSGGPYYDVLLGRLDGRVANQSGADNGLPSPFEPVDSIIQKFAAVGLNTTDVVVLSGAHTIGRARCALFSNRLSNFSATDSADPTLEASLADSLQSLCAGGNGDGNETAALDVSSPYVFDNDYYKNLLTERGLLSSDLGLFSSPEGVAASTKDLVEAYSSDGDQFFYDFVWSMIRMGNIPLAAGSDGEVRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 2 ESTs. Also found in AC185444.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCGCTACTCTTGCTGCCGTTGGGTGCTTGCGTGTTCTATCCTTGCCCTGTGCCTCGGTGGGCAGGGCGCGAGGTGCCAGCTGACGTCGGATTTCTACGACAGCACCTGCCCTCAG
CTGTACTACGTCGTGCAGCAGCACGTGTTCGACGCCATGAGAGAGGAGATGAGGATGGGCGCCTCCCTCCTCAGGCTGCATTTCCACGACTGCTTTGTCAAT
GTACGTACGTAACTGTCA
TCGCTCGATCTAGCTCTGAGCTCTCGGCTGAACATGCATGTTCTTTTCTACTATGAATGAATCCATCCATGACGCTCGTGCGTGCGTGCGTGCGTCCAGGGGTGTGACGCTTCGATCCTT
TTGGACGGCGACGACGGCGAGAAGTTTGCGCTGCCCAACCTCAACTCCGTCAGAGGGTACGAGGTCATCGACGCCATAAAGGCTGACCTCGAGAGCGCGTGCCCCGAGGTGGTGTCGTGC
GCGGACGTCGTAGCCCTCGCGGCCAGCTACGGAGTACTCTTC
GTAAGCCTTTTCGCAGTCTCGATCTGTCGGAACATCTCCAGCTTTGTTTAGGGTTTGTCAGACGAATTGAAGGGCGAC
TAACACACACACTGCGACGATGTTCTTCTCCAGAGCGGAGGGCCTTATTACGATGTTCTTCTCGGGAGGTTGGACGGGCGGGTGGCCAATCAGTCCGGAGCCGACAACGGTTTGCCGTCG
CCGTTCGAACCCGTCGACTCGATCATCCAGAAGTTCGCCGCCGTCGGCCTCAACACGACCGACGTCGTGGTCTTATCAG
GTAACCAAACCAACAGTCTCGTCGATCCAGTTGCTCAGAGA
TATATGGAGCTCCCTCTTCCTTGTGATCTGATTCAGTAACACCTGAACTCGATTGAAACGAACAGGAGCCCACACCATCGGGCGAGCCCGGTGCGCGCTGTTCAGCAACCGGCTGTCCAA
CTTCTCGGCCACGGATTCAGCGGACCCGACGCTGGAGGCCAGCCTCGCCGACAGCCTCCAGAGCCTCTGCGCGGGCGGCAACGGCGACGGCAACGAGACCGCCGCGCTCGACGTCAGCTC
CCCCTACGTGTTCGACAACGACTACTACAAGAACCTGCTGACGGAGCGGGGCCTCCTGTCCTCCGACCTGGGCCTCTTCTCCAGCCCCGAAGGCGTCGCCGCCAGCACCAAGGATCTGGT
GGAGGCCTACAGCAGCGACGGCGACCAGTTCTTCTACGATTTCGTCTGGTCCATGATCAGGATGGGGAACATCCCGCTCGCCGCCGGCTCCGACGGGGAGGTCCGCAAGAACTGCAGAGT
AGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCGCTACTCTTGCTGCCGTTGGGTGCTTGCGTGTTCTATCCTTGCCCTGTGCCTCGGTGGGCAGGGCGCGAGGTGCCAGCTGACGTCGGATTTCTACGACAGCACCTGCCCTCAG
CTGTACTACGTCGTGCAGCAGCACGTGTTCGACGCCATGAGAGAGGAGATGAGGATGGGCGCCTCCCTCCTCAGGCTGCATTTCCACGACTGCTTTGTCAAT
GGGTGTGACGCTTCGATC
CTTTTGGACGGCGACGACGGCGAGAAGTTTGCGCTGCCCAACCTCAACTCCGTCAGAGGGTACGAGGTCATCGACGCCATAAAGGCTGACCTCGAGAGCGCGTGCCCCGAGGTGGTGTCG
TGCGCGGACGTCGTAGCCCTCGCGGCCAGCTACGGAGTACTCTTC
AGCGGAGGGCCTTATTACGATGTTCTTCTCGGGAGGTTGGACGGGCGGGTGGCCAATCAGTCCGGAGCCGACAAC
GGTTTGCCGTCGCCGTTCGAACCCGTCGACTCGATCATCCAGAAGTTCGCCGCCGTCGGCCTCAACACGACCGACGTCGTGGTCTTATCAG
GAGCCCACACCATCGGGCGAGCCCGGTGC
GCGCTGTTCAGCAACCGGCTGTCCAACTTCTCGGCCACGGATTCAGCGGACCCGACGCTGGAGGCCAGCCTCGCCGACAGCCTCCAGAGCCTCTGCGCGGGCGGCAACGGCGACGGCAAC
GAGACCGCCGCGCTCGACGTCAGCTCCCCCTACGTGTTCGACAACGACTACTACAAGAACCTGCTGACGGAGCGGGGCCTCCTGTCCTCCGACCTGGGCCTCTTCTCCAGCCCCGAAGGC
GTCGCCGCCAGCACCAAGGATCTGGTGGAGGCCTACAGCAGCGACGGCGACCAGTTCTTCTACGATTTCGTCTGGTCCATGATCAGGATGGGGAACATCCCGCTCGCCGCCGGCTCCGAC
GGGGAGGTCCGCAAGAACTGCAGAGTAGTCAACTAA

Retrieve as FASTA