Entry information : AmelPxt01
Entry ID 3670
Creation 2007-01-09 (Marcel Zamocky)
Last sequence changes 2016-01-15 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-15 (Christophe Dunand)
Peroxidase information: AmelPxt01
Name AmelPxt01
Class Invertebrate peroxinectin    [Orthogroup: Pxt001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Apidae Apis
Organism Apis mellifera (Honey bee)    [TaxId: 7460 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AmelPxt01
start..stop
S start..stop
NviPxt02 922 0 28..774 26..774
TcasPxt02 637 0 93..772 33..696
FchPxt01 449 3e-148 102..770 4..652
PlenPxt01 452 5e-148 102..770 137..785
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2354969..2355050 82 N° 2 2361450..2361593 144 N° 3 2375031..2375337 307 N° 4 2377658..2377875 218
N° 5 2380546..2380584 39 N° 6 2381676..2381852 177 N° 7 2382003..2382199 197 N° 8 2382310..2382493 184
N° 9 2382740..2383082 343 N° 10 2383176..2383506 331 N° 11 2383657..2383855 199 N° 12 2383945..2384054 110
join(2354969..2355050,2361450..2361593,2375031..2375337,2377658..2377875,2380546 ..2380584,2381676..2381852,2382003..2382199,2382310..2382493,2382740..2383082,23 83176..2383506,2383657..2383855,2383945..2384054)


exon

Literature and cross-references AmelPxt01
Literature Zhang,L. et al., Direct Submission(04-NOV-2010) Human Genome Sequencing Center, Department of Molecular and Human Genetics, Baylor College of Medicine.
Protein ref. GenBank:   XP_392481.4
DNA ref. GenBank:   NW_001253451.1 (2354969..2384054)
Protein sequence: AmelPxt01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   776
PWM (Da):   %s   87089.28  
PI (pH):   %s   7.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLIAPVDNNRWAYTMHGLEKPMDHVSAGGLMAGSVATLAILWVSLQTMGFLGNTHTIGAYKLPISLQNYLASYTGLPMTNYPYEGGVVDTGRTHNRRYPHIDEAVLNNSISFAQSLVDRMSTLERNIANAGVELMAHTPAGKQFLDSYPSEDAFERGLDAIVAMKASSYLLHQSCHRFGLDPPHRARFISTLSLEGTPLNSTCPSSRHKGCNSLAKYRNIDGSCNNVQNPSWGSAMTAYTRILFPQYFGCPGREILSSSRMWIQEPRRMGHTRKPLPGARSISVAVSTPNDQSDVSRTLTVMQWGQFVANDISYTPMRKMVSTGKPISCCRSDGNTLSPRYVHPDCSVIMVPDRDPIYGQHYVRCMNYVRSLPVLKAECTFGPAEMNQASHFLDGSAIYGSTLKKSRQLREFEGGRLRVHKESNHEFLPIGEDEISSACAKNCYNSGDYRVNTHPQLAVIHTIWHREHNRIADKLAELNPNWSDETLFQEARRIVIAEIQHITYKEWLPILLGKRYTRAVGLTVGNSYSRNYNSEDDPAISNEVATAALRFLTSLMQGKISLTDDKRQINKTVSLSEYFFKPIIIESDEVFDGLLRGMATQTSQKMDVSIIEDVTSKLFAAGQDSLGLDAISLDIQRGRDHGLPGYNHYRKYCGLPIANTFDDFLDYISVMMKKLRALYAHPDDVDLIIGGMAERPVDDGLLGPTFRCLIFEQFSRTRRTDRYFYDSAYQPHPFTPEQLAQIRNVTLARIFCDNGNNITQMQPNVFLRPQAE

Retrieve as FASTA  
Remarks Complete sequence from genomic. Strain="DH4". Similar to peroxinectin. Phylogenetically on the branch with Dm chorion peroxidase
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTTATTGCACCAGTGGACAATAATCGCTGGGCCTATACGATGCACGGATTGGAGAAGCCTATGGATCACGTGTCTGGTAATGTGCCTGCTAACTATATTTTAAATATTTACTCG
TAATCAATGCCTTTTATTATCCGGTATCTTGACGCACACGTAAGATTTTCATGATTTTTATTATATAGAAGCAAACAAAGATTTTGTAAAATTTAAATATTCGTGTATTATTATATCTAT
ATTAATTTTCTTTAATCCTTTAAATTATCCAAAATTAAAATTAAAATTTAATTATTCTTTCCAAGTTTAAGCATCATTGTTAAAAAATAAAAGATAATTATATTATTGTAAGACGCGAGG
AGTAAGACTAATAATGCCTAGAGATTTAATTTTATTTTATCCTCGTGTTTTATTACAATGTTCGGTTCCGTTAATTTAGTTGGCCTACAAAATAACAGGCAGTAAAGAAAATAATATCAT
TTTCAATATTTCAATAAAAGCACACGTACTTAAAATATTTATTTCCTACGATAAGTAAATCGTTTTGTAAATCGCTTGCTCGCAAACTAATACAATTTTTCTAACTTTTTTATTAAAAAT
AACGACAGTAATAAAATATGTATTATTTATCTCGATTATACATTCTAAACGAATTTTGTGAAAGTTAGAAAATAGAAAATTCGAGATATTTAATACTATATTTCAAATGTTATACTTTAT
TATTATTATTTATTATTCTTAGAATTTTATATTGATTTTTTTTTTTTTTTTTTACGATTTCTATACTCCAAGTATTTTCTCTAGTACAGTATCTTGTTACTGTTATGAAATATAGAATGT
AGCTACTTATCTCTCAGAGTATTGTACTCGTTCACCTCGTACTACTGCACTGGTAGATATATACGATATACCGCTTGAATATATAAATTTAATAATTTAATATTAATAACCAATTTATTT
CTTATTCAAAGTACGGACATTAAAAGGAAAACAATAGTTTTCAATTCTAAGGAAGAAATTTTAATTATGTAGTAATCTCAAAAATATTGAATTTTTAATTTTTATCGTAAAAACTTTTTT
ATTCGAGTATGTTTATATCTAAATAGCAAGACAAGACAAGTTGAAGACAATATTACGAAAGTAAATATTGAGACACACGTCCTGGGAATTCGACCGGTAATTTCCGAATCCAAACGAATT
ATTCTATACAACGTGTGTGTTCAAATTCTCACATCATACAGTGGAAAAAATTGTTAAATTAAATATTGAGTCAACTTTACGAAATCCACGGAATCGACAATTAAGATTGAAAGAAAATTG
ACCGAGTATTTCATAGTGAAAAATTGAATTGAATGAGCTGATTACTTGTCTCTTTCTTGCTCTATTGTTTCTCTTGCTTCTGAAAACATTACTTAAATTATTCGTATATATATTTGTATA
AAAATACATAAGTTAAACGAAATTTGAAACTTTTATTGAAATTTCAAATAAAAAAAAAAAAGAAAGAAAAAAAGAGGAAAAAATGTTGAGTACAAACAATAATATTGATTTTTCGTATCT
GAAATGTTATCTAGGTCAAGATACTATTTTTTAAAACACTTAGTCATTTATCAATATCTCGATTGCACTTATATTTATATGTATATAGTTATATAAATAACATACATACAAATAAAAATT
TTTAAAAAAGATATCAATAACGAAATTGCATCGTATAATGCAAAATATTCTAACATTATATTTAAACGTAGTATAATAGTGAATATGTATGTATATACAGTAGTTAGAAAGTGAATTTTC
ATATTGCCCTTGTTAGAAATATTTTAAAATTAAAATATCTTGTCGTACTTTATCTACTGTACATTATTGATTGAAAAATGTGGTAGTGAAAAAATTTAAAAAATATTTTTGTGAACGATC
AAATGATACGATAAATAAAAAAAAAAAAATAAAATTTATTCAAAAATTGAAATGGAAATTTTGATAAGTTATAAGTAATAAATTATTTTTTTAAACTAATATCATGCTATAATGGTGGAT
TTTGAGTCATTATTATTGTAGAAAATAATTTTAAAAATTCGTAGAAATATACGATGTGTTTTTAATTACAGCTAATTTAATATTCTAATAATAATCATACAAGTGTTTGAATTAATAAAG
ATGAATTAATACATTGAAAAAAACATTTGCACTCCATATGCGTTGTATATTCGTTTTTTTAGATTAATGTGGATTATACAAAAGAAACGAATAAAATTAAAGAATAATTAATAAGTTTAT
ATAACTATAATATATATTAGAATATTAAATTCTAATATTAGCACCAGCAATATGATATTAATTTAAAAGTTAATTTAAATGATTTAAGAAAAATCTTGAATCAAATTAAAATTTGATTAT
GAAATGTAAACTAAGTAAACTAACTCTAACTTTTAATAATTCTAAATTATCCGTTTATAAATCTTTTTATTCGAAAAAAAAAACATTTTAGAAAATTGTAATTCTCACCATTTCTAATTT
CAAATCTAAACCTCTTCTGGAATATTTTATAATATAATAAAATAAAATTGAAAGATTACTCTTTATATTATTGGAATGGCCATTAAGCGTATTCGGTTTATTAAAGTGATGATTGTAATA
ACCGTTGTAACTTGAGCTACACCGTGATGTAACGAAACTCATCTTCTTCAACTCGTACTCGTAGAAAGGAGGCGTGAAAAATGCGCCTCTGTATTTTACAGCAGCAACATATGGCATTCA
TTTTATAAACACGTATCTCGATGAGACGTGCTGGCAAAAATCGAGTTATCTGGTTAAAAAAAAAAAAAAAAAAAAGTAGAAGAACGTCTACGTTTCCTTCGCACAATTGCATTTAACTGT
AAATTCGCATTTTCATTTTTAAACAAATCACACCTTCGACACTATTTCCGTTCTCACGAAGAGGTATTCCACAATCAGGATATGTAATGAATCATTCTCGTTAGACGCGACTAAATTTAA
ATACGATTACGCTCACTTTGTAACTTTGTTTCGAAAAAGAAGATTTATTGTTTACGTTTGTAAAACCGAAAGATAGGATAGGAAGAGGATATTTTCATTTCTTATAAATATTTTCGATTT
ATATTCGAAAACAGAAACGATTAGATAATTTTACCGCTTTACGTTATATAGTATAAGTCATGCATAGAAATTATTTTGAGACATTTATATTTAGAAATTGATACTCCAAATATGAAATTT
CTCGAAATAATTTCTTCGTATATATTTTTATGTTATCATATTTCGTTGAATATTGAATTGGATTTGTAATAATTAATGTAACTTAGTAATCTAAATTAATATAACTATACTAATCGAACT
TATACTGCTACGATTTTCAACCTTCCATCAGACTAAAAATTATGCTAAGAGCACTAAGATTCTACTAGAAGATAGATCTTGTTGAAGAAATGATAATGAAAAGTGTAGAATTGAAAGGAG
GTAATTTGAGATTGCGAAATCAAAGCTAAGAATTGGGATTATTTATTCTGGAAACTGCTAAATTTAGATTTCTTATAATACTATTTCAGTAAAAGTCATTTCGGTTTTCTGAAAGAGAAA
TGAGATTGAAATTGGATCGTAGCCAATTATTCTTTTACAGAATTGATATTGTAAATTTGTGATTCTATTTTGAACTATCTCACGAATTATCTTACAACTGAAATAAAAAAGATCGAATGT
AATTTAAATTCATTCATAACTATAATAGTTTTGAAAATTTATTTTCAGCTATCTAAAGTATATTTTTATCTGTCTTGTTTATTCGAATATACATATATAACGACGATAAAACTTTTATTC
AATAAATTAATTCAATTGTATCGATATGTTGAATGATACAAAAAAATTTAATAAATTCTAATAATTTACTATTCACATCCATAGTAAAATATCAGAATAAAGTTCAATAAGATTTCTTAT
TTATATACATCGTGTATAAAAAAATGTTTATGTCTTTTCGAAGATATGATATAATTTATCATAATTTAAGGACAATCGCAATTTTTCCTTTTCACGTGTATCTCAAGACCATATAAAGTA
GCTATAAATATTCTACGCAACTGACTTTGTGTACAGTATGAAGATCGAAGTAAAGAAGAAGAAAAAAAAAAAATTACCGATCATTTTATGTTGTTCAAACATTTCTTCTATATATCTTAT
AATATCTTATAACAACTACGTAATTGTTTGTTAATGAACTATTGTTTGGTATTATATCAACAGCATTATTGTCAGCAATTATTATGATAATGATTTTATCCAGGCGTTGAAAATACACCG
ACACTCGATTTCTGTATTTTAAATTGACAAAAAAATTATAGACAGGTGAAAAATAAATAAGAAAAAAAAAGAAAAGAAAAAGAAGAGATATATCGTTTAATAAACGATGAATATAATGAA
TATTGATGTATGTATACACGCATACATTATAACTTGAAAATGTGTGATGCGATAGAACGAAGGCGCCATCAATTTGCGATCGTTTCTTGCGTACGAAGCAAAATTAAATTAAAGCCGAGG
GAATATTAAGAGCGCAGAATTTCTCGTAAACAATCGAACTACGTAATATTGAAAATCACGTGGTACGAAACGAATGCACGACATGTGTACTTATAAAAGAAGTTTTACGCAAATTTACAA
CATTTTGCTGATAATTGAAAAAATTGAATAATCCTGAAAATGTTGTTCTCGATTATAAGTGAGAAATTGTGTCTTTTTTTTTAGAAACGAGCATAATAATCTGATCTATCGATTTAATAT
ATATTGATGAAAAGAATAATTGCTTGACAATCCAAGCAACGATTTAACTTATTCGTTAATGTTTTTTTTTTTTATTATTTAAAATTTCGCTAAAAGATAGCGAAAAATGTTGAAGTTAAT
TATTTTTTAACTTTGAATGAATTGAATGAAGTTCGTCGAACTTTGTTTGTTTCGATATCCAAAGTAATATTTGTTACTTAAAAATGTTTATTTGAAATTGCCTGTAAATTGACATAATTT
TGAAATCAAATCTTACGTATTTTGATAAGTATTAAGAAATTTGTTGGGTTCAATAGAATCTAATGTTTTATATGTCGCAAGAAATGTTTTCTATGATTTCGTCTAAGTGAAAAATATGTT
TTATAATCAATTAGACGAAATAGCGAATAAAAAATAAGGTATTACATTATTTATGATAACAAATGATATATGAAATATTTCAAAATACTGTTTTCTAAACGTTTAAACATTATTTATAAT
CGTACGAGTAAATAGTAATGAGATACGATAAATAATAAGTAAAATTGTATAATAATAAGTTGTTCTATGATATACTATTTTATACCTCTTTTTTAATTCGATGATTATATTTCTAGCTTT
ATTGTGAAAATTAAGCAATTTTAAAAATCAATATTTTTCGAAAAAAATTTCACATCTCTGATCTCATTTTCACGAAATAAAAAAATGAAATTAAAGGTGAGAACAAATTTCAGATCAGGT
TTATCTAACTTTGACGCTCTCAAAAATTTATTTTCGATTTTTTAAACTTATTTCACATACTTTCCTGTTAATTATAAAAGAATTATAATCTCCTTTACTATCTACGTAGTATATAAGTTA
AATGCAAGATAAAATTAATAAAACCATTTGACGTTGTTACTATAAAAAAAAAAAAAAACAAAATTCTATAATTACATTAACTCTGAATTAAATTTATATCGTTGATAACCTTACTATCAA
TGACGTCAATGTTTTTTCAAACTTCATTTCATTATCTTAAATGTGATGTGGAATGAACAATATCCTACAACCATAATTATTAGAATAATTTGAACGTTCAACACAATAACAATTTTGATT
GTACATTAAATTTAAATTTTACCTAGAAAAATCTAAATGCATCTAAAAGATCCTAAATCATTTCAATCGAATATGATTGAAAAAGGAGATATGCAATTTTTATTTAAAATGAAATTAACA
AATGAGAAAGTGTAAACGAAAATATATTATTTACAAATAATTAAAAATTTTTAACCAGAATAATTTATATTCGTTTTTTAATAATAAATCCTGATTTTATCTATATATACATATATCCTT
CTGTATATAAGTTGATGTGATGTATAAAAAAAAAAAAAAAGAAAAGAAAGGAAAAGAAAAGACAAGTCAAAATCTTACAAGAAGTTCTCCACGTAACGATTTCGATCGATTAATCATTAC
AATAAATCTCAAATCCTTTTGAATTATTGTACTAAACAAAAAGCACGTTGTTACGCGAAATGACTCAACTAACCACTTCAAGATAATAACAATTGCGTCGTAGTTTTTCGCGATAAAGGA
AATTCATTTCGATTAGTAGTTCTATAAGTACGTCGAATCAATTTAGTCAAAGAATTTAAGATTTTTAGAAGATAGAAAGCATATTATATAAAAAAAAAAAAAATTGTTTGATTCTGTGCA
GCTGGTGGCCTAATGGCAGGTTCCGTGGCTACCTTGGCGATCCTATGGGTCTCTCTACAAACCATGGGATTCCTTGGAAATACGCATACGATCGGTGCCTATAAATTGCCAATTTCCTTG
CAGAACTATCTTGCCAGTTATACAG
GTAAGTTGTCCTCATTTTTCCTCCATTTTATTATATTATTATTTTCTTTTTTTTATCTATCGAAGAAAATTTTAATCGCAGTGTGTTTGATGATA
AGATTTTATCCTGGATTACTATCAATATACGGAGTTGAACGCTTATCAATGTTATAAATATTTTCTTTTAGAGTTTATATATATATATATACATGTTGCATTTTAATCCAGGATCAAATA
CATCATCCTTTGATAAAAATCAATAAAAGTATTGTAAAAAAAAAGTAATGTAAATATATGCAATATTGCTTAACATTGTTTGTTGTGAATTGTATTTGTGAAAATATTATTGAAACTATA
AATTAGAATTAGAAATATGTTTGATAATTTTCCAATGTTCAATTAAATTTCATATTTTCAAGAAAGAGAGAAACATGGAAGGAATGTTTACTTTTTTAAATAAGAATATTTTTAATTTTC
AACTTATAATATTTTGATGCTTTTTATCAATATCTATGATTTGTTTTCCTATAATTTTCTTATATTATCTATATCCATACATTTTATATATAGATTTATACAATTGTCAAACATCCATTT
CTAATTGATAATTATGAAATATCTAATATTTAATAATCATTTTATTTTTAAACGATATTTGAAATAAATAACGAACACAATTGTAACAAATACAAATTGTGTTCGCATCTTTATCATCTT
GCAATTTGAAATTCTATTAAATTGCAACAACAAAAATTTCTACTCGTACTTCAAAATACTTATAACGACAATAATTTAATTTCTACATAATCTGAATGAAACACAATGAACAAACATTAA
GAATTAAAACTCTTCTTCTTGTTTCAAAAATTTTCCAAAGAATACAATATTTTACCGATAAAAAAAAAAAAAAAATTCTTTCCACAACATTTATGCGTTTTCTTAATAAATAATACGCAT
ACCACAATAATTATCCGTTATAAAATTGGAGAAGATATCTTAAACACGTAAATTTAGAAACATTAACAGTTGCAAATTTCTACTAAGAAATGGAGAAAGAAAGAGAAAGAAAATAATTAT
ACGTACTTTTCCTCCTCCATGTATCTTTGTGCCTCGCACAAATTATTTTCAACAATTCGTACAGAAAAAAAAAAAAAAGAAACTTGAAAAAGGCTGCGATCCGTTAGATCCCGTGTACAA
CCCGGTTGAATTGATTGAATTCCTTTTTTACCGACGTTTTTAAAGGTATCCTTTCAGGTTTGCCGATGACAAACTACCCTTACGAGGGCGGCGTCGTAGACACGGGTCGTACCCATAATC
GGCGTTACCCTCACATTGACGAGGCGGTCTTGAACAACTCGATCAGTTTCGCGCAAAGCTTGGTCGATCGTATGAGCACCCTCGAAAGGAATATCGCGAATGCTGGCGTCGAATTGATGG
CTCACACGCCGGCTGGAAAACAATTCCTTGATTCATATCCTTCCGAGGATGCTTTCGAGAGAGGCCTCGACGCCATAGTGGCGATGAAAGCTTCGTCCTATCTCCTTCATCAGAGCTGTC
ACAGGTAACATTACACCTCTTAGGTCAAAGGTCAATTTCTGATTAGCTGTTTACACACGTCTATATCAGGATGTTTCCTTTTTATTACCGGTGAAAAATGTCGCCTTTGGGATTAATTCA
GCGTTTAAAAGTAAATCGAGGAAAATTTATATATTTGTATCTGAAATATATTTATTCCTATTTTAGGGATTAAGATTTTCTTTTAGGGGTTGCTTATTTTCGAACAAATTATTCAATTTC
GATTATTTTGAAGATTGGTAATGGGAGTTTAGAAAATTAACGTAACAAAGTATTTTTTTTAATTACTGTTATTACGAATTCATTGGCGGACGATGCATGTTACTTTCGAACGCTGAATCT
TTCTTTAAAGTGGATTATAAAAATAAAAAAAAGAATATTGTATTTAATATATCATCTGGAAAAATTGGAGGAAATTGTGCAAAAGGAAGATTCTTTTTTCAAAAAGGGAGATTTCCAAAT
TTCATATTACTTAAACACTTGATGTTGAAATTGAATTTTAGTCTATTAACATTCATCTCTATATGTTCTCATCTAATTCTATTCAAAATGTAGACTTTCTATGTGAAATGCATAATAAAA
AAAAAATTTTTATAAAAGTATTTACAATGGGAAAAATTCAATATACCGAAATAATTTTTCGTTCAATCAATTATCTACTTCGAATAAATAAATAGATACTTTTTGTTGTTTCTATTTTTC
TTGAAAACGAATCATATGACATGATAATGTTAAATATTATCATTATTTTGATTTATCTAAAAGGTTATAAAATGGTGCAATATTAGAACAAATATCAGAAATCTTATTCTTCGATTAAGC
AATTTTGATTTATAGATATTTCATTACAATTTTCGTACTAAAAAAAAAAACTATTAACTTGTAAATCTATTTGTTGCTTAAATTCTCGCTGTTTGCAAAATATCGATTGAATTTATTTTA
TTGTAATGTTTCGCCTATAATCAAACTAATAAAAATGCCTTTTTGCACAATGAGCAATTCGTTAAAAGAATTGTTTCCTACTGGGATATCAAAAGATGGTTAGAAGATTGTCACTTATGT
AATTAAAATATTGTAATAATTACATTTTATTTATTATAAATATTTTAAAACCATCTTCTGAACTCCTAACAGTGCTTCATTCTCTAAAAATGTAAAATTCTACCTTCTATATTCTAAAAT
TCACCAACTAATAATTCTTTCGAAATTTTTAATTGAATATTGACACAACAATTCTATGTTCAATCATTTATCATTTCCTATTTATTTTTTTTTAATTTCTACGTTACACGTTTAAATTTA
TATGACAAATGATCCTCAACTATCCTCAACTATATCATCTTTACACGACGAATGATTTTGTGTTTTAAAATATTATGGAGAATTATTCCTCGTGAAATTACCAACTTTGCATAAAATAAG
ATTTTATTTATTTAAAAATTTTATGAAACTAAATATTATATATTTTATATTTCATAAAATTTTTTACGAAGTCACTTTATTACGTTGCTTTAAATTTCTTGAATAAAAATAAGAAAGAAA
TTATTTTCAAATTAAAAAAAAAAAAGAAAGAAAAAAAATATATATATATAAAGGTAATGTATGCAATTTAAAAAGTATTTAAAAAGATATAAATTTAAATTTTTATATTCTATATTCCTA
TCTAATTTCTACCAACATAATTCAAACATCATTCAAAACACTTCAAGAGTGTTAAATTTATTGCTCCTCGTCACAATCACCGTTATATATTCGTTATACATTTCTTTTTTCATTATTAAA
AGCATTCAATATTATCAACTTTATTATTTGCTTAAATATCTCATTGAAGATTATTGCCACTTCGAATACAATATCAACGTTTAACCAAGCAAATTGATCATACAAATTACTCTTGCAAAA
ACTTAACTCGCGTGTTAGATCCACCTCTGAATTTATATTATACACAGAAGCACAAAATCTCTCTTGCCGCAAAAAAAATTGACAGCCTTAAATAATATATCCCATATATATATATATATA
TATATATATATATATATATATATATATATATATTCGTATGGTAGCATGTTGTCACCATCGATAGTAGTGAAACACGTGGGCGCCTGTTTACTGTTTCCGCCGCTACTCGTGATTCGCAAG
AAACATTTAATCGAATCGACCGATCGATATTTGTTACAGATTCGGGCTGGACAAAGACGATTGCGCTCGTTTCATATCGACCTTGTCGCTGGAGGGGACTCCGTTGAACTCGGCCTGTCC
GTCATCGCGGCACAAGGGGTGCAATTCTCTGGCCAAGTACCGAAACATCGACGGCAGTTGCAATAATGTCCAAAATCCAAGCTGGGGTAGTGCGATGACCGCGTACACCAGAATTCTCTT
CCCCCAGTATTTCGACGGTAAGGGTGTTTCCTACCGTGTGACGATCAGCAAAGAAAAGAAAAAGAAAAAGAAAAAGAAAAGGAAAAAGAAAGAAATTTTAAAGACAAATGACTTGTCTAC
CATATTTCACTACAATCGTCCGTTTTAGAGAAATTCGCGAAAAAATTCGTCGACGGTCTACGGCTCGAAATTATTATCGTTTCGTTTCTCGCTGGGCACACTTCGGTTTTTTTTATCTCT
CGCTCGTAGCGTAACGCGATACGCGTCGTTTGCTGTGTTTTTTACGCTCGGCTTTGGACGGAATCGGACATTCTGGACGGACGCAAGAAACGGAAGCGGCGAACGGGAAGAAGAATATTA
TCGAGATACATTTGAACCCTCTATGTACCGTGTTGTTGTCGTTATTTGTGTGGAATAATAATCGTTCAATTATTTGCAGCCTCTGAACGCTCTTGGCGCTTCCTTCTTCTCCTTTTCTCA
CGTATCCGTCCCCTCACTCCTCTGATTGTCGTTTGATATTTTTTTTTTTTTTCTTTTGTTGTACTAATTTCTTCTGGAAGGGAATGATTTCGTTTCTTTTCTTTTAACTTACGATTTAGA
ACGGCCGATGATCCAAGGATATTATTTTGTCGATCACGTTTGTACGCGATTTTCTTGTGGAAAGAAAAGATTCCATCTATATTCTTATTCTTATGGGATATAGGATGTGTTTGATCTGTT
TTCATCTGTGTTGTGGAGATGTATTTTGTGTCCCACGTTCGATCATCTATTTTCTAATTCCGATTTCTGAATTCATTGAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTCCTCTCCAACGAATATATATATATATATATATATATATATATATATATATATATTCGCCTGAGAAGAAACCCTAACTTTTATCCCTAAGGATAGGGAACGTTTT
GCGATGAAAAAAAAAAAAAAAAGAAAGAACAAAACACCCTGTAAATACATAGATATATAGCGTGTATAGAACATTTCAAGTAAGATACATAGACCGTAACTTTCGAAGAAACGAGCTCCA
GAAAATACATTGCAAGAGCGTCAGAAACAACTGAGGATCGTTCGTTCGTGTTAAGCGCGAGCGATAAAGATAGAATATTACGAGAATGTGTAGGAGCTTCGGTAAATAAGCGAGCGCAAG
AGAGGGGGTTGAATAGAAAAGAGAGAGAGGATAGAGAGAATTCTGTAGTCCGTAAACGCGGTGCTCGTGTTCAGTCGTCTTCAGTCCAACTTGGATACGCTCCTCGGCTTGTCCTCAGCA
GCCAGTTTTCATAAACGTATCCGCGAAATATTTTTCCCACTTTGCCGTGAATTGAACCAAAGGTGAATGCACCTGTACGAGCAGATACTCCAACTAGAGTATCTATTCCAAGACTAACGA
GTTCATTAACGAAACCGGTCTAATTTATTTGAAATTTCTATCAGAAGGAAAATCTTCTCCTTCTGTTTGATCAATCTCGTCTCAACTCAACGTGTGCGCGTCGAAATTAATAGGAAAATT
CGTAATTGGATGTGTCGATAAAACGGAAATAAACGTATCTAACCGCGAACATTGCTATTCCGCTTTTGCGTGCTGAGAATGTTTCTTATTGCACCAGTGGACAATAATCGCTGGGCCTAT
ACGATGCACGGATTGGAGAAGCCTATGGATCACGTGTCTGGTAATGTGCCTGCTAACTATATTTTAAATATTTACTCGTAATCAATGCCTTTTATTATCCGGTATCTTGACGCACACGTA
AGATTTTCATGATTTTTATCATATAGAAGCAAACAAAGATTTTGTACATGTAAAATTTAAATATTCGTGCATTATTATATCTATATTAATTTTCTTTAATCCTTTAAATTATCCAAAATT
AAAATTAAAATTTAATTATTCTTTCCAAGTTTAAGCATCATTGTTAAAAAATAAAAGATAATTATATTATTGTAAGACGCGAGGAGTAAGACTAATAATGCCTAGAGATTTAATTTTATT
TTATCCTCGTGTTTTATTACAATGTTCGGTTCCGTTAATTTAGTTGGCCTACAAAATAACAGGCAGTAAAGAAAATAATATCATTTTCAATATTTCAATAAAAGCACACGTACTTAAAAT
ATTTATTTCCTACGATAAGTAAATCGTTTTGTAAATCGCTTGCTCGCAAACTAATACAATTTTTCTAACTTTTTTATTAAAAATAACAGTAATAAAATATGTATTATTTATCTCGATTAT
ACATTCTAAACGAATTTTGTGAAAGTTAGAAAATAGAAAATTCGAGATATTTAATACTATATTTCAAATGTTATACTTTATTATTATTATTTATTATTCTTAGAATTTTATATTGATTTT
TTTTTTTTTTTTACGATTTCTATACTCCAAGTATTTTCTCTAGTACAGTATCTTGTTACTGTTATGAAATATAGAATGTAGCTACTTATCTCTCAGAGTATTGTACTCGTTCACCTCGTA
CTACTGCACTGGTAGATATATACGATATACCGCTTGAATATATAAATTTAATAATTTAATATTAATAACCAATTTATTTCTTATTCAAAGTACGGACATTAAAAGGAAAACAATAGTTTT
CAATTCTAAGGAAGAAATTTTAATTATGTAGTAATCTCAAAAATATTGAATTTTTAATTTTTATCGTAAAACTTTTTTATTCGAGTATGTTTATATCTAAATAGCAAGACAAGACAAGTT
GAAGACAATATTACGAAAGTAAATATTGAGACACACGTCCTGGGAATTCGACCGGTAATTTCCGAATCCAAACGAATTATTCTATACAACGTGTGCGTTCAAATTCTCACATCATACAGT
GGAAAAAATTGTTAAATTAAATATTGAGTCAACTTTACGAAATCCACGGAATCGACAATTAAGATTGAAAGAAAATTGAGTATTTCATAGTGAAAAATTGAATTGAATGAGCTGATTACT
TGTCTTTCTTGTCTCTATTGTTTCTCTTGCTTCTGAAAACATTACTTAAATTATTCGTATATATATTTGTATAAAAATACATAAGTTAAACGAAATTTGAAACTTTTATTGAAATTTCAA
ATAAAAAAAAAAAAGAAAGAAAAAAAGAGGAAAAAATGTTGAGTACAAACAATAATATTGATTTTTCGTATCTGAAATGTTATCTAGGTCAAGATACTATTTTTTAAAACACTTAGTCAT
TTATCAATATCTCGATTGCACTTATATTTATATGTATATAGTTATATAAATAACATACATATAAATAAAAATTTTTAAAAAAGATATCAATAACGAAATTGCATCGTATAATGCAAAATA
TTCTAACATTATATTTAAACGTAGTATAATAGTGAATATGTATGTATATACAGTAGTTAGAAAGTGAATTTTCATATTGCCCTTGTTAGAAATATTTTAAAATTAAAATATCTTGTCGTA
CTTTATCTACTGTACATTATTGATTGAAAAATGTGGTAGTGAAAAAATTTAAAAAATATTTTTGTGAACGATCAAATGATACGATAAATAAAAAAAAAAAATAAAATTTATTCAAAAATT
GAAATGGAAATTTTGATAAGTTATAAGTAATAAATTATTTTTTTAAACTAATATCATGCTATAATGGTGGATTTTGAGTCATTATTATTGTAGAAAATAATTTTAAAAATTCGTAGAAAT
ATACGATGTGTTTTTAATTACAGCTAATTTAATATTCTAATAATAATCATACAAGTGTTTGAATTAATAAAGATGAATTAATACATTGAAAAAAACATTTGCACTCCATATGCGTTGTAT
ATTCGTTTTTTTAGATTAATGTGGATTATACAAAAGAAACGAATAAAATTAAAGAATAATTAATAAGTTTATATAACTATAATATATATTAGAATATTAAATTCTAATATTAGCATCAGC
AATATGATATTAATTTAAAAGTTAATTTAAATGATTTAAGAAAAATCTTGAATCAAATTAAAATTTGATTATGAAATGTAAACTAAGTAAACTAACTCTAACTTTTAATAATTCTAAATT
ATCCGTTTATAAATTTTTTTATTCGAAAAAAAAACATTTTAGAAAATTGTAATTCTCACCATTTCTAATTTCAAATCTAAACCTCTTCTGGAATATTTTATAATATAATAAAATAAAATT
GAAAGATTACTCTTTATATTATTGGAATGGCCATTAAGCGTATTCGGTTTATTAAAGTGATGATTGTAATAACCGTTGTAACTTGAGCTACACCGTGATGTAACGAAACTCATCTTCTTC
ATACTCGTAGAAAGGAGGCGTGAAAAATGCGCCTCTGTATTTTACAGCAGCAACATATGGCATTCATTTTATAAACACGTATCTCGATGAGACGTGCTGGCAAAAATCGAGTCATCTGGT
TAAAAAAAAAAAAAAAAAAAGTAGAAGAACGTCTACGTTTCCTTCGCACAATTGCATTTAACTGTAAATTCGCATTTTCATTTTTAAACAAATCACACCTTCGACACTATTTCCGTTCTC
ACGAAGAGGTATTCCACAATCAGGATATGTAATGAATCATTCTCGTTAGACGCGACTAAATTTAAATACGATTACGCTCACTTTGTAACTTTGTTTCGAAAAAGAAGATTTATTGTTTAC
GTTTGTAAAACCGAAAGATAGGATAGGAAGAGGATATTTTCATTTCTTATAAATATTTTCGATTTATATTCGAAAACAGAAACGATTAGATAATTTTACCGCTTTACGTTATATAGTATA
AGTCATGCATAGAAATTATTTTGAGACATTTATATTTAGAAATTGATACTCCAAATATGAAATTTCTCGAAATAATTTCTTCGTATATATTTTTATGTTATCATATTTCGTTGAATATTG
AATTGGATTTGTAATAATTAATGTAACTTAGTAATCTAAATTAATATAACTATACTAATCGAACTTATACTGCTACGATTTTCAACCTTCCATCAGATTAAAAATTATGCTAAGAGCACT
AAGATTCTACTAGAAGATAGATCTTGTTGAAGAAATGATAATGAAAAGTGTAGAATTGAAAGGAGGTAATTTGAGATTGCGAAATCAAAGCTAAGAATTGGGATTATTTATTCTGGAAAC
TGCTAAATTTAGATTTCTTATAATACTATTTCAGTAAAAGTCATTTCGGTTTTCTGAAAGAGAAATGAGATTGAAATTGGATCGTAGCCAATTATTCTTTTACAGAATTGATATTGTAAA
TTTGTGATTCTATTTTGAACTATCTCACGAATTATCTTACAAGTGAAATAAAAAAGATCGAATGTAATTTAAATTCATTCATAACTATAATAGTTTTGAAAATTTATTTTCAGCTATCTA
AAGTATATTTTTATCTGTCTTGTTTATTCGAATATACATATATAACGACGATAAAACTTTTATTCAATAAATTGATTCAATCGTATCGATATGTTGAATGATACAAAAAAATTTAATAAA
TTCTAATAATTTACTATTCACATCCATAGTAAAATATCAGAATAAAGTTCAATAAGATTTCTTATTTATATACATCGTGTACAAAAAAATGTTTATGTCTTTTCGAAGATATAAACATGA
TATAATTTATCATAATTTAAGGACAATCGCAATTTTTCCTTTTCACGTGTACCTCAAGACCATATAAAGTAGCTATAAATATTCTACGCAACTGACTTTGTGTACAGTATGAAGATCGAA
GTAAAGAAGAAGAAAAAAAAAGAAAAAAAAATTACCGATCATTTTATGTTGTTCAAACATTTCTTCTATATATCTTATAATATCTTATAACAACTACGTAATTGTTTGTTAATGAACTAT
TGTTTGGTATTATATCAACAGCATTATTGTCAGCAATTATTATGATAATGATTTTATCCAAGGCGTTGAAAATTACACCGACACTCGATTTCTGTATTTTTAAATTGACAAAAAAAATTA
TAAGACAGGTGAAAAATAAATAAGAAAAAAAAAAGAAAAAGAAAAAGAAGAGATATATCGTTTAATAAACGATGAATATAATGAATATTGATGTATGTATACACGCATACATTATAACTT
GAAAATGTGTGATGCGATAGAACGAAGGCGCCATCAATTTGCGATCGTTTCTTGCGTACGAAGCAAAATTAAATTAAAGCCGAGGGAATATTAAGAGCGCAGAATTTCTCGTAAACAATC
GAACTACGTAATATTGAAAATCACGTGGTACGAAACGAATGCACGACATGTGTTCTTATAAAAGAAGTTTTATGCAAATTTACAACATTTTGCTGATAATTGAAAAAATTGAATAATCCT
GAAAATGTTGTTTTCGATTATAAGTGAGAAATTGAGTCTTTTTTTTAGAAACGAGCATAATAATCTGATCTATCGATTTAATGTATATTGATGAAAAGAATAATTGCTTGACAATCCAAG
CAACGATTTAACTTATTCATTAATGTTTTTTTTTTTCATTATTTAAAATTTCGCTAAAAGATAGCGAAAAATGTTGAAGTTAATTATTTTTTAACTTTGAATGAATTGAATGAAGTTCGT
CGAACTTTGTTTGTTTCGATATCCAAAGTAATATTTGTTACTTAAAAATGTTTATTTGAAATTGCCTGTAAATTGACATAATTTTGAAATCAAATCTTACATATTTTGATAAGTATTAAG
AAATTTGTTGGGTTCAATAGAATCTAATGTTTTATATGTCGCAAGAAATGTTTTCTATGATTTCGTCTAAGTGAAAAATATGTTTTATAATCAATTAGACGAAATAGCGAATAAAAAATA
AGGTATTACATTATTTATGATAACAAATGATATATGAAATATTTCAAAATACTGTTTTCTAAACGTTTAAACATTATTTATAATCGTACGAGTAAATAGTAATGAGATACGATAAATAAT
AAGTAAAATTGTATAATAATAAGTTGTTCTATGATATACTATTTTATACCTCTTTTTCAATTCGATGATTATATTTCTAGCTTTATTGTGAAAATTAAGCAATTTTAAAGATCAATATTT
TTCGAAAAAATTTTCACATCTCTGATCTCATTTTCACGAAATAAAAAAATGAAATTAAAGGTGGGAACAAATTTCAGATCAGGTTTATCTAATTTTGATGCTCTCAAAAATTTATTTTCG
ATTTTTTAAACTTATTTCACATACTTTCCTGTTAATTATAAAAGAATTATAATCTCCTTTACTATCTACGTAGTATATAAGTTAAATGCAAGATAAAATTAATAAAACCATTTGACGATG
TCACTGTAAAAAAAAAAACAAAATTCTATAATTACATTAACTCTGAATTAAATTTATATCGTTGATAACCTTACTATCAATGACGTCAATGTTTTTTCAAACTTCATTTCATTATCTTAA
ATGTGATGTGGAATGAACAATATCCTACAACCATAATTATTAGAATAATTTGAACGTTCAATACAATAACAATTTTGATTGTACATTAAATTTAAATTCCAGAAAGATCTAAATGCATCT
AAAGATCCTAAATCATTTCAATCGAATATGATTGAAAAAGGAGATATGCAATTTTTATTTAAAATGAAATTAACAAATGAGAAAGTGTAAATGAAGATATATTATTTACAAATAATAATT
TAAAAATTTTTAACCAGAATAATTTATATTCGTTTTTTAATAATAAATCTTGATTTTATCTATATATACATGTATCCTCCTGTATATATAAGTTGATGTGATGTATAAAAAAAAAAAAAG
AAAAGAAAGGAAAAGAAAAGACAAGTCAAAATCTTACAAGTTCTCCACGTAACGATTTCGATCGATTAATCATTACAATAAATCTCAAATCTTTTTGAATTATTGTACTAAACAAAAAGC
ACGTTGTTACGCGAAATGACTCAACTAACCACTTCAAGATAATAACAATTGCGTCGTAGTTTTTCGCGATAAAGGAAATTCATTTCGATTAGTAGTTCTATAAGTACGTCGAATCAATTT
AGTCAAAGAATTTAAGATTTTTAGAAGATAGAAAGCATATTATATAAAAAAAAAAAAAAATTGTTTGATTCTGTGCAGCTGGTGGCCTAATGGCAGGTTCCGTGGCTACCTTGGCGATCC
TATGGGTCTCTCTACAAACCATGGGATTCCTTGGAAATACGCATACGATCGGTGCCTATAAATTGCCAATTTCCTTGCAGAACTATCTTGCCAGTTATACAGGTAAGTTGTCCTCATTTT
TCCTCTATTTTATTATATTATTGTTTTCTTTTTTTTTATCTATCGAAGAAAATTTTAATCGCAGTGTGTTTGATGATAAGATTTTATCCTGGATTATTATCAATATATGGAGTTGAACGC
TTATCAATGTTATAAATATTTTCTTTTAGAGTTTATATATATATATATACATGTTGTATTTTAATCCAGGATCAAATATATCATCCTTTGATAAAAATCAATAAAAGTATTGTAAAAAAA
AAAGTAATGTAAATATATGCAATATTGCTTAACATTGTTTGTTGTGAATTGTATTTGTGAAAATATTATTGAAACTATAAATTAGAATTAGAAATATGTTTGATAATTTTCCAATGTTCA
ATTAAATTTCACATTTTCAAGAAAGAGAGAAACATGGAAGGAATGTTTACTTTTTTAAATAAAAATATTTTTAATTTTCAATTTATATTTAATATTTGGATGCTTTTTATCAATATTTAT
GATTTGTTTTCCTATAATTTTCTTATATCATCTATATCCATACATTTTATATATAGATTTATACAATTGTCAAACATCCATTTCTAATTGATAATTATGAAATATCTAATATTTAATAAT
CATTTTATTTTTAAACGATATTTGAAATAAATAACGAACACAATTGTAACAAATACAAATTGTGTTCGCATCTTTATCATCTTGCAATTTGAAATTCTATTAAACTGCAACAACAAAAAT
TTCTACTCTTACTTCAAAATACTTATAACGATAATAATTTAATTTCTACATAATCTGAATGAAACACAATGAACAAACATTAAGAATTAAAACTCTTCTTCTTGTTTCAAAAATTTTCCA
AAGAATACAATATTTTACCGATAAAAAAAAAAGATTCTTTCCACAACATTTATGCGTTTTCTTAATAAATACCACAGTTTAAATAATTATCCGTTATAAAATTGGAGAAGATATCTTAAA
CACGTAAATTTAGAAACATTAATAGTTGCAAATTTCTACTAAGAAATGGAGAAAGAAAGAGAAAGAAAATAATTATACGTACTTTTCCTCCTCCATGTATCTTTGTGCCTCGCACAAATT
GTTTTCAACAATTCGTACAGAAAAAAAAAAAAAAAAAAAGAAAGAAACTTGAAAAAGGCTGCGATCCGTTAGATCCCGTGTACAACCCGGTTGAATTGATTGAATTCCTTTTTTACCGAC
GTTTTTAAAGGTATCCTTTCAGGTTTGCCGATGACAAACTACCCTTACGAGGGCGGCGTCGTAGACACGGGTCGTACCCATAATCGGCGTTACCCTCACATTGACGAGGCGGTCTTGAAC
AACTCGATCAGTTTCGCGCAAAGCTTGGTCGATCGTATGAGCACCCTCGAAAGGAATATCGCGAATGCTGGCGTCGAATTGATGGCTCACACGCCGGCTGGAAAACAATTCCTTGATTCA
TATCCTTCCGAGGATGCTTTCGAGAGAGGCCTCGACGCCATAGTGGCGATGAAAGCTTCGTCCTATCTCCTTCATCAGAGCTGTCACAG
GTAACATTACACCTCTTAGGTCAAAGGTCAA
TTTCTGATTAGCTGTTTACACACGTCTATATCAGGATGTTTTCCTTATTATATCCGGTGAAAAATATCGCCTTTGGGATTAATTCAGCGTTTAAAAGTAAATCGAGGAAAATTTATATAT
TTGTATCTGAAATATATTTATTCCTATTTTAGGGATTAAGATTTTCTTTTAGGGGTTGCTTATTTTCGAACAAATTATTCAATTTCGATTATTTTGAAGATTGGTAATGGGAGTTTAAAA
AATTAACGTAACAAAGTATTTTTTTTTAATTACTGTTATTACGAATTCATTGGCGGACGATGCACGTTACTTTCGAACGCTGAATCTTTCTTTAAAGTGGATTTCGTTTATAAAAAAAGA
ATATTTAATATATCATCTGGAAAAATTGGAGGAAATTGTGCAAAAGGAAGATTCTTTTTTTCAAAAAGGGAGATTTCCAAATTTCATATTACTTAAACACTTGATGTTGAAATTGAATTT
TAGTCTATTAATATTCATCTATATACGTTCTCATCTAATTCTATTCAATATATGGACTTTCTATGTGAAATGCATAATAAAAAAAAAAATTTTTTATAAAAGTATTTACAATGGGAAAAA
TTCAATACACCGAAATAATTTTTCGTTCAATCAATTATCTACTTCGAGTAAATAAATAGATACTTTTTGTTGTTTCTATTTTTCTTGTAAACGAATCATATGACACGATAATGTTAAATA
TTATCATTATTTTGATTATTTATCTAAAAGGTTATAAAGTGGTGCAATATTAGAACAAATAGAAACTCGAAATCTTATTCTTCGATTAAGCAATTTTGATTTATAGATATTTCATTATAA
TTTTCGTACTAAAAAAAAACTATTAACTTGTAAATCTATTTGTTGCTTAAACTTTCGATGAAAATTCTTGCTGTGTTTGCAAAATATCGATTGAATTTATTTTATTGTAATGTTTTGAGC
CTATAATCAAACTAATAAAAATGCCTTTTTGCACAATGAGCAATTCGTTAAAAGAATTGTTTCCTATTGGGATATCAAAAGATGGTTAGAAGATTGTAATTAAAATATTGTAATAATTAT
ATTTTATTTATTATAAATATTTTGAAACCATCTTCTGAACTCCTAACAGTGCTTCATTCTCTAAAAATGTAAAATTCTACCTTCTATATTCTAAAATTCACCAACTAATAATTCTTTCGA
AATTTTTTAATTGAATATTGACACAACAATTCTATGTTCAATCATTTATCATTTCCTATTTATTTTTTTTTAATTTCTACACGTTTAAATTTATATGACAAATGATCCTCAACTATGTCA
TCTTTACACGACGAATGATTTTGTGTTTTAAAATATTATGGAGAATTATTCCTCGTGAAATTACCAACTTTGCATAAAATAAGATTTTATTTATTTAAAAATTTTATGAAACTAAATATT
ATATATTTTATATTTCATAAAATTTTTTACGAAGTCACTTTATTACGTTGCTTTAAATTTCTTGAATAAAAATAAGAAAGAAATTATTTTCAAATTAAAAAAAGAAAGAAAATATATATA
TATAAAGGTAATGTATGCAATTTAAAAAGTATTTAAAAAGATATAAATTTAAATTTTTATATTCTATATTCCTATCTAATTTCTACCAACATAATTCAAACATCATTCAAAACACTTCAA
GAGTGTTAAATTTATTGCTCCTCGTCACAATCACCGTTATATATTCGTTATACATTTCTTTTTTCATTATTAAAAGCATTCAATATTATCAACTTTATTATTTGCTACTTAAATATCTCA
TTGAAGATTATTGCCACTTCGAATACAATATCAACGCTTAACCAAGCAAATTGATCATACAAATTACTCTTGCAAAAACTTAACTCGCGTGTTAGATCCACCTCTGAATTTATATTATAC
ACAGAAGCACAAAATCTCTCTTGCCGCAAAAAAAATTGACAGCCTTAAATAATATATCCCATATATATATATATATATATTCGTATGGTAGCATGTTGTCACCATCGATAGTANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAATTGACAGCCTTAAATAATATATCCCATATATATATATATATATATATA
TATTCGTATGGTAGCATGTTGTCACCATCGATAGTAGTGAAACACGTGGGCGCCTGTTTACTGTTTCCGCCGCTACTCGTGATTCGCAAGAAACATTTAATCGAATCGACCGATCGATAT
TTGTTACAGATTCGGGCTGGACCCCCCCCACCGCGCTCGTTTCATATCGACCTTGTCGCTGGAGGGGACTCCGTTGAACTCGACCTGTCCGTCATCGCGGCACAAGGGGTGCAATTCTCT
GGCCAAGTACCGAAACATCGACGGCAGTTGCAATAATGTCCAAAATCCAAGCTGGGGTAGTGCGATGACCGCGTACACCAGAATTCTCTTCCCCCAGTATTTCGACG
GTAAGGGTGTTTC
CTACCGTGTGACGATCAGCAAAGAAAAGAAAAAGAAAAAGAAAAAGAAAAGGAAAAAGAAAGAAATTTTAAAGACAAATGACTTGTCTACCATATTTCACTACAATCGTCCGTTTTAGAG
AAATTCGCGAAAAAATTCGTCGACGGTCTACGGCTCGAAATCATTATTATCGTTTCGTTTCTCGCTGGGCACACTTCGGTTTTTTTTATCTCTCGCTCGTAGCGTAACGCGATACGCGTC
GTTTGCTGTGTTTTTTACGCTCGGCTTTGGACGGAATCGGACATTCTGGACGGACGCAAGAAACGGAAGCGGCGAACGGGAAGAAGAATATTATCGAGATACATTTGAACCCTCTATGTA
CCGTGTTGTTGTCGTTATTTGTGTGGAATAATAATCGTTCAATTATTTGCAGCCTCTGAACGCTCTTGGCGCTTCCTTCTTCTCCTTTTCTCACGTATCCGTCCCCTCACTCCTCGTCTG
ATTTTTTTTTTCTTTTGTTGTACTAATGCAATTTCTTCTGGAAGGGAATGAATTTCGTTTCTTTTCTTTTCTCTAATTTACGATTTAGAACGGCCGATGATCCAAGGATATTTTGTCGAT
CACGTTTGTACGCGATTTTCTTGCGGAAAGAAAAGATTCTATCTATATTCTTATTCTTATGGGATATAGGATGTGTTTGATCTGTTTTCATCTGTGCTGTGGAGATGTATTTTGTGTCCC
ACGTTCGATCATCTATTTTCTAATTCCGATTTCTGAATTCATTGAGAAGAGTAATAAGAGATTGGTAATAATTTTTTGGTTGTTGCATTATTAATACAGGGTGTCCTAGAAATACGTAAT
ACTTTCGATTAACATATATTATATATTAATTTGCCAAGTAATATTCTGCAAATGCAACCAGAAATTGAATATGGATTGTCCTCTTGGTAAAATTTATTAAAGAAAAGAATTATCGTTGAA
AAAGTTGTTTTTCGATGACTAATTCTTTTTATTCTGTCTGTTTTTACACTTGAATAAACTTACACTTCTTCTCAGTACAAAATGTTTCACGTTTAGATAAAAAAGATTATTAATAATATC
GAAAATATTTGAAACGGAAATGTTTATCGAATAACATTATCGAATGAAAATATTCTTTTTCTAAAAAATTTTTATTCCTTAAATTATACGAAACATGTGAAAAATTTAAAGTAGGCTAAA
TAATTCCAAGTATATTTCTGACTCACACGCCTGCATATGTATGTTTCTAAATACCTAAGAATATTACTGAAACGATAAATAGTACGATAAATTTTTTTTTTTTAAATGGAGATTTAAGTA
CTTTGTGTCTCGTATGTAAAGCAGCGTGCTGTATTTATGCAGAATAATAATTCAAGGACATCGATTCATATACATTTCTCTATGCATACAAGCATATTCTAATTTTATTTTACTTTTACT
TTTTACGTACATAATTGAAAAATTGAAATATCAAATATCGTACGAATCATTCTTTTCATATTAATCCTAGGACACTCTGTAATTACATTGTATTCCGTTACACGATGAATTAAAAATGAA
AAAGAATCCTTCAGTTTCAATCTAACTCTATCTAAGTCTATTCGATTATACACATCTTTGATCAGGTTTTTCTTTAATCGTTCATTTTCGAACAAATTTGATTCACAACGAGTCATCATC
ACACTGTCGGAGTTACATTATTTTTTTTAAAAATTCTTCGTCTCCCTCGTCGGCCGTTGATTATATTTAACGAAAATATTCCGCAAAATATCCGATAAGGAAAGAAAGAAACTTTTCTCG
AAGAACGAAAATATAAAATGATTCTTTCATATTCATGATTCGATGATGGTATAAGCGAGTTACCAGCACAGCCTCGACCTACTAACCCACCTCTACTACTCCTCATATCGACACCTCGCA
AAAGTATATACGATCACACACGACACGCAGAAGAAAAAAAAATATATATCACACACGTTTGTCACACAACAGGCCGAAATACACAATTGTTATACGTTGTACACAATGTATTCTAGTGCT
ACCAAGTTCAAAAATTTACCTATTCACTTCTGATACTTGAAAAGATTTTATTGATTTATCTTAACATTTTTTTCTACTTTATATATTTCATCCTCGATTCGTTCGATAATTACATCTTGT
TGTAGTATCAATTTGCAAAATTGATACGATCTTATCTTTCCTTATTGTATCCTCAATTTTTTTATTAATCGTTTCAGATTAATTCTGAAATAATAGCCATTACAATCGTCGAATATTTAA
AAACGTCACGTCACGTTCAAAACATAAATTTATTCTTCCATTCTTCTATAAAAATTTCTTTTATACACAGATGATATATATATATATATATTTCTTCCCGACGAGCAAGTAGTTTTCAAA
ATCGATACGATATCAATATATACTACATTTTGTACTACCTGTCTGTGTTACGTACACGTACAAAAAAAAAAAAACGAACACACTCTCTTATCCTTGGGCGCTAATGGACACACAAAAAAA
AAAAAAAAAAAAAAACGACGTTCGTCGATTGGCTTAACAAATTATATTCTGTGATTTGCATTACAGTTGTTGTGCGATAAGGCACATAAGAGCATAAAATGCCTGAGTGTAGCAGTGAAT
AATACTGCCTACAATAGGGTGCCCCGGTCGGGAGATTCTATCCAGCAGTAGAATGTGTATGTAAACTAATTCGGATATATCTAATAATGTATCATATTTATATATATTATATATATATTG
TAACACACTAGTTCAAATATTTTTTCTGTTGATTGCGGTATACGGGTCTCGTTAAAGGTGTCCGAGGTAAGCGAATGAAAATTGGGAGTCATTCGCGACGATTCCAATTATCTTTTTTTT
TTTTAAATCCGTTCTTCAAATCTTCGTTTTTTGTTTCTTTATATACGTATATGCATTTATACAAGCAGTTGTATATCATCAAGCATCCATCATCTCCCAATTTGATTTTCTCACTATTGG
GCACCTTCATCAGCCACATAGATAAGTCACTTGATCCCTTCTGTAAGCGTTCTCGACGTGATTCTTCCTTTTTCAATTCATCATTGCATCCATCTTGTGGTAAATTAGAATAGAATGTGA
ATTAAAAAAAAAAAAAAAGAACGAGAAAATAATAATCCGTTCTCAAGCGTCGATAACGCATCAGAATATCACGTCAAAAAAAAAAAAATAAGTAGAAGACAAGTATTTTGTACTGCTCTG
CAGCGCGAGAGTCGTCGTCGTCGTTTCGTTCGGTCGATTCAGAGATCAATCAGCGTATTCAGAAAAAAGAAAAATAGAAAGAAAAAGAAGAAGAAAAGAAAAACTTTAATTCGAAAAGCA
ATCATCGTCGCTGAAATTTTAACTCACTTTAAATATGTCATTTACTGATTGATCTCTGATGAATTTCGCGTGCTGAGGCAGGTTTTATAGGATAGGATCCTCGTATTGCAGGGATTGGAA
ACCTCGATTCCAATTGATTCAGTATCGCGAACTGTTTCTCGCTCTCGCGCTGCACCAACATTATTTCACACGCATACGCGGAGATCACCTGCAAAAAATATTGTCGAAATCGGAGTAATG
ATGATCTTTCCAAACCTTTCTCTCTTCGAGTTTGATCATGAACTATTTAACAAAAAATTCTTAAATATCGTCGTTTCAATTTTTCCAATCGTTGAGAAATCGAATATTACGAATATTACT
CCGATTAGGCGACGAGAGGTGTCACGAGGTAACGTAACGCGGGCCTAATGCTTAATTTGGCGATCAGGGATCCAAGAACCGAGGCGTATGGGGCACACGAGAAAGCCGCTACCCGGCGCA
AGAAGCATAAGCGTGGCCGTGTCGACGCCCAACGATCAGTCGGACGTCAGCAGAACTTTGACGGTGATGCAGTGGGGCCAGTTCGTTGCGAACGACATTTCTTACACCCCCATGCGCAAA
ATGG
GTAAGCGTTTTCTTTTCAAAGTTGAAAAAGATTATTATACACGCGTGACAATATGACACGTATTCTTTCGAATTAAATATTTGCAATGAAAATTCATTTTCATCGATATGTATTAC
GATCCTTGTGCAAATAATTATAAAATTATTGCAGTGTCGACAGGAAAGCCGATCTCGTGCTGTCGATCAGACGGAAACACCTTATCGCCTAGATACGTACACCCTGATTGTTCCGTAATT
ATGGTACCTGATCGAGATCCTATTTACGGGCAGCATTACGTACGATGCATGAATTACGTGCGATCGTTGCCCGTCCTTAAAGCGGAATGTACGTTTGGACCCGCGGAACAG
GTATATATT
TTTCATTTCTTTTATTTCCTTTAATATGAATGATAAAAAAATTTGAAAGAAAAGAATAGGGTTGTTAGAATCAAGTCTTTAATCGATTTTTTCGACGACAGATGAATCAAGCGAGCCACT
TTTTGGACGGTTCGGCGATCTACGGTTCTACGTTGAAAAAATCCCGTCAACTGCGCGAGTTCGAAGGGGGTCGCTTACGAGTTCACAAGGAGAGTAACCACGAATTCTTGCCGATCGGGG
AGGATGAAATCTCGTCCGCGTGCGCGAAAAACTGTTACAATTCTG
GTGAGCATTTTCCTACTCTCGATTTGCAATCGACCACGGAAAGAATAAAATCTTTAAAATATTTTATCCTCTTTT
TTCGTAAATGATGATTCGAGCATTAAATTAAAAGACGCATTTTTCTTCGTCCCCTCTCCCCAAGTTTCATTCCAAGTTTCAATCTAAATTTCATATTTCATATATTATATATTTATCATA
TTTCATTTATTATATATTTCAAATTTCATATATATACTCTTAATTGGTCAGGCGATTATCGCGTAAACACGCATCCACAACTCGCTGTGATACACACGATCTGGCATCGCGAGCACAACC
GAATAGCCGACAAACTCGCCGAGCTGAATCCAAACTGGTCGGACGAGACGCTGTTCCAAGAGGCTAGGCGCATAGTTATTGCTGAAATTCAGCATATCACGTACAAGGAGTGGCTACCTA
TATTGCTGGGCAAGAGGTACACCCGCGCCGTTGGTCTCACAGTTGGCAACAGCTACAGTCGTAATTACAATTCCGAGGATGATCCAGCGATCAGCAACGAGGTCGCGACTGCGGCTCTCC
GCTTCTTGACTTCTTTGATGCAAGGAAAAATAAG
GTAAATTTATTTTTTCATTCTATGTGACGTATATACAAAATGAAAAATATGTATCTTCAATTTTGTTATTTTTATGATTCTGTGTT
TGTACAGTTTGACAGACGACAAACGCCAGATCAACAAAACGGTTTCCTTGTCGGAATACTTCTTCAAACCGATTATAATCGAGTCTGACGAAGTGTTCGACGGTTTGTTACGCGGGATGG
CCACTCAGACCAGCCAGAAAATGGATGTCAGCATAATCGAAGACGTAACGAGCAAGTTATTCGCCGCGGGTCAAGATAGCTTAGGCTTGGACGCGATCAGCTTGGACATTCAACGTGGTC
GTGATCATGGCCTGCCAGGTTACAATCATTACAGAAAGTATTGCGGTCTTCCAATTGCGAACACCTTCGATGATTTCTTGGATTACATTTCAGTGGAG
GTAAAAATTATTTCGAGTATAT
ACGATGATTTAATTGGACGTATTTTTCATACATCGAATTAATAATAACTATTATCATTAAAATTCATTGTTTGAAAAGAAATATTTTTCCAAATTATTTTTATAATCCAAAATTTAATCA
ATTAACAGATGATGAAGAAATTGCGCGCACTTTACGCTCATCCCGATGACGTAGACCTTATTATCGGGGGTATGGCCGAGAGGCCAGTGGATGATGGCCTATTAGGACCCACCTTCCGCT
GTTTAATATTTGAACAGTTTTCGAGAACCCGTCGCACCGACAGATATTTCTACGATTCTGCGTATCAACCGCATCCCTTCACACCCG
GTAAGAGAATACATTAAAGAATTGACATTTATA
TTTGGAAATATTGATATAAGTTTTAAGAGTACAAATTGTAACTTTGTGTTGAACAGAGCAATTGGCACAAATACGCAATGTAACGTTGGCAAGAATATTTTGCGACAATGGTAACAATAT
TACCCAAATGCAACCGAACGTATTTCTCCGGCCACAAGCAGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTTATTGCACCAGTGGACAATAATCGCTGGGCCTATACGATGCACGGATTGGAGAAGCCTATGGATCACGTGTCTGCTGGTGGCCTAATGGCAGGTTCCGTGGCTACCTTGGCG
ATCCTATGGGTCTCTCTACAAACCATGGGATTCCTTGGAAATACGCATACGATCGGTGCCTATAAATTGCCAATTTCCTTGCAGAACTATCTTGCCAGTTATACAG
GTTTGCCGATGACA
AACTACCCTTACGAGGGCGGCGTCGTAGACACGGGTCGTACCCATAATCGGCGTTACCCTCACATTGACGAGGCGGTCTTGAACAACTCGATCAGTTTCGCGCAAAGCTTGGTCGATCGT
ATGAGCACCCTCGAAAGGAATATCGCGAATGCTGGCGTCGAATTGATGGCTCACACGCCGGCTGGAAAACAATTCCTTGATTCATATCCTTCCGAGGATGCTTTCGAGAGAGGCCTCGAC
GCCATAGTGGCGATGAAAGCTTCGTCCTATCTCCTTCATCAGAGCTGTCACAG
ATTCGGGCTGGACCCCCCCCACCGCGCTCGTTTCATATCGACCTTGTCGCTGGAGGGGACTCCGTTG
AACTCGACCTGTCCGTCATCGCGGCACAAGGGGTGCAATTCTCTGGCCAAGTACCGAAACATCGACGGCAGTTGCAATAATGTCCAAAATCCAAGCTGGGGTAGTGCGATGACCGCGTAC
ACCAGAATTCTCTTCCCCCAGTATTTCGACG
GGTGCCCCGGTCGGGAGATTCTATCCAGCAGTAGAATGTGGATCCAAGAACCGAGGCGTATGGGGCACACGAGAAAGCCGCTACCCGGC
GCAAGAAGCATAAGCGTGGCCGTGTCGACGCCCAACGATCAGTCGGACGTCAGCAGAACTTTGACGGTGATGCAGTGGGGCCAGTTCGTTGCGAACGACATTTCTTACACCCCCATGCGC
AAAATGG
TGTCGACAGGAAAGCCGATCTCGTGCTGTCGATCAGACGGAAACACCTTATCGCCTAGATACGTACACCCTGATTGTTCCGTAATTATGGTACCTGATCGAGATCCTATTTAC
GGGCAGCATTACGTACGATGCATGAATTACGTGCGATCGTTGCCCGTCCTTAAAGCGGAATGTACGTTTGGACCCGCGGAACAG
ATGAATCAAGCGAGCCACTTTTTGGACGGTTCGGCG
ATCTACGGTTCTACGTTGAAAAAATCCCGTCAACTGCGCGAGTTCGAAGGGGGTCGCTTACGAGTTCACAAGGAGAGTAACCACGAATTCTTGCCGATCGGGGAGGATGAAATCTCGTCC
GCGTGCGCGAAAAACTGTTACAATTCTG
GCGATTATCGCGTAAACACGCATCCACAACTCGCTGTGATACACACGATCTGGCATCGCGAGCACAACCGAATAGCCGACAAACTCGCCGAG
CTGAATCCAAACTGGTCGGACGAGACGCTGTTCCAAGAGGCTAGGCGCATAGTTATTGCTGAAATTCAGCATATCACGTACAAGGAGTGGCTACCTATATTGCTGGGCAAGAGGTACACC
CGCGCCGTTGGTCTCACAGTTGGCAACAGCTACAGTCGTAATTACAATTCCGAGGATGATCCAGCGATCAGCAACGAGGTCGCGACTGCGGCTCTCCGCTTCTTGACTTCTTTGATGCAA
GGAAAAATAAG
TTTGACAGACGACAAACGCCAGATCAACAAAACGGTTTCCTTGTCGGAATACTTCTTCAAACCGATTATAATCGAGTCTGACGAAGTGTTCGACGGTTTGTTACGCGGG
ATGGCCACTCAGACCAGCCAGAAAATGGATGTCAGCATAATCGAAGACGTAACGAGCAAGTTATTCGCCGCGGGTCAAGATAGCTTAGGCTTGGACGCGATCAGCTTGGACATTCAACGT
GGTCGTGATCATGGCCTGCCAGGTTACAATCATTACAGAAAGTATTGCGGTCTTCCAATTGCGAACACCTTCGATGATTTCTTGGATTACATTTCAGTGGAG
ATGATGAAGAAATTGCGC
GCACTTTACGCTCATCCCGATGACGTAGACCTTATTATCGGGGGTATGGCCGAGAGGCCAGTGGATGATGGCCTATTAGGACCCACCTTCCGCTGTTTAATATTTGAACAGTTTTCGAGA
ACCCGTCGCACCGACAGATATTTCTACGATTCTGCGTATCAACCGCATCCCTTCACACCCG
AGCAATTGGCACAAATACGCAATGTAACGTTGGCAAGAATATTTTGCGACAATGGTAAC
AATATTACCCAAATGCAACCGAACGTATTTCTCCGGCCACAAGCAGAGTAA

Retrieve as FASTA