Entry information : MtPrx44 (Medtr2g084000.1[4.0] / Medtr2g084000.1[3.5] / Medtr2g098080.1[3.0])
Entry ID 368
Creation 2005-06-16 (Christophe Dunand)
Last sequence changes 2010-09-15 (Haythem Mhadhbi)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx44 (Medtr2g084000.1[4.0] / Medtr2g084000.1[3.5] / Medtr2g098080.1[3.0])
Name (synonym) MtPrx44 (Medtr2g084000.1[4.0] / Medtr2g084000.1[3.5] / Medtr2g098080.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Root tips
Roots
Inducer Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx44
start..stop
S start..stop
MtPrx28 545 0 1..319 1..318
PsPrx11 543 0 1..319 1..318
MtPrx43 534 0 1..319 1..318
MtPrx97 511 0 1..319 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35276908..35277120 213 N° 2 35275903..35276094 192 N° 3 35275180..35275734 555  
complement(join(35275180..35275734,35275903..35276094,35276908..35277120))


exon

Literature and cross-references MtPrx44 (Medtr2g084000.1[4.0] / Medtr2g084000.1[3.5] / Medtr2g098080.1[3.0])
Literature Manthey,K. et al., unpublished
DNA ref. Phytozome 11:   chr2 (35277120..35275180)
Cluster/Prediction ref. Phytozome Gene 11:   31065655 UniGene:   Mtr.9089
Omic ref. Gene atlas:   Mtr.43159.1.S1_at Legoo:   Mtr.43159.1.S1_at
Protein sequence: MtPrx44 (Medtr2g084000.1[4.0] / Medtr2g084000.1[3.5] / Medtr2g098080.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 319 (295)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
34427.56 (31842.2)  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.36 (9.35) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 25 range:25-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATLIKFFVTLSIFSLLACSTINAQLSPNFYAKTCSNLQTIVRNEMIKVIQKEARMGASILRLFFHDCFVNGCDASILLDDKGTFVGEKNSGPNQGSARGFEVIDTIKTSVETACKATVSCADILALATRDGIALLGGPSWAVPLGRRDARTASQSAANSQIPGPSSDLSTLTRMFQNKSLTLNDLTVLSGAHTIGQTECQFFRNRIHNEANIDRNLATLRKRNCPTSGGDTNLAPFDSVTPTKFDNNYYKDLIANKGLLHSDQVLFNGGGSQISLVRKYSRDGAAFSRDFAAAMVKMSKISPLTGTNGEIRKNCRIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2) and 18 ESTs. ESTs are incorrectly compiled in the UniGene Mtr.9089. Cultivar="Jemalong".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCTTGATTAAATTCTTTGTTACACTCTCTATATTTTCTCTCTTAGCTTGTTCAACCATTAATGCACAACTTTCTCCGAACTTTTATGCAAAAACTTGCTCTAATCTCCAAACC
ATTGTGCGCAATGAAATGATCAAAGTTATCCAAAAGGAAGCCCGGATGGGGGCTTCTATACTTCGATTGTTCTTCCATGATTGCTTTGTAAAT
GTAAGTCTTATTACCATGTTCAAAATA
TGATTTAATTTTACTTTATCTCACATTCTATCAATCATCTTTATCACTCCATAACTTATATAATTTAGATGAGATGAGTTTCTTGAGATTTAATGTAGAAGAGAAATGTTTTTTTTTACG
TCAAAACTTTGATAGAATTGGTGTTGTTTGATTAGAGTTATGTTTAAAGGTTTGGTGGATAAAATTGGTGTAGTCGTGAATCGTGTTAAAATATTGTCTTGGGGTGTGGTTTATTCGTAG
ATAAGAGAGAAATGTAAGGATTGATTTCTTTGGGTTTCTTAAGTTTGTAACTCGTTTTGTTGTATGAAGGGTTAGAGCAATCCTTGTCCTCTTATTATAAATCTTCTTGCGGTGCTCTCG
TTTAGATCATATTGACATATCATATATCATCTTTGATTCATTGCATATTCAATTAATGACTCTGACGTCAATGTTACAGATTAGGAGACAAGATTATCTCAATCATTTTAATTTTTCAAT
ATTTTTTGTTGACATCTTATCGTTTTATGTTATTAGCTTGTATGTTGTAAGTTTGATCACAATTTTTTGTAGTAAACAAATTCAAAAAGCAATGAATATTACTATCATGCATGTGTTTTT
AACATCACATAATAAACTACTCCTGCTCCATAGTGAAGTTACAGTAATAAATATTATATTCTTTTTTCAAAACAAAAAAAAATCACGGGCTAGACTTCAGTTACTATTTTAGTCACGGGT
TATCTTTATTTTCTGTAAAAAAAATTACATTAACATGTGTGAGTTTTATTTTTGTTTATTTGGTAGGGATGCGATGCATCAATCTTATTGGATGACAAAGGAACATTTGTCGGTGAGAAA
AATTCTGGACCTAACCAAGGTTCAGCTAGGGGTTTTGAAGTGATTGATACAATTAAAACCAGTGTTGAAACTGCTTGCAAAGCCACCGTCTCTTGTGCTGATATTCTTGCACTTGCAACT
AGAGATGGAATTGCATTG
GTAAGTCATATATGTGTGTCCTATAAGACATGAAATATAAACTAGGGTTAATATATGTTTAACCTCTATAATATTAATGGTTTCTGGTTTACCCCTATGTAA
AAAATATTAACCCTATATATAAACAATATGTGTATCCTATAACCATGTTTCAATTAATTTATATAGCTTGGAGGACCCTCATGGGCAGTACCACTTGGAAGAAGAGATGCAAGAACAGCA
AGTCAAAGTGCAGCAAATAGCCAAATCCCTGGACCATCTTCTGACCTATCGACACTCACTAGAATGTTTCAAAACAAAAGTCTAACATTAAATGACCTTACAGTCCTATCTGGTGCACAC
ACCATAGGGCAAACTGAGTGTCAATTTTTCAGAAATCGCATACACAATGAAGCCAACATTGACAGAAACTTGGCTACCTTAAGAAAAAGAAATTGCCCTACCTCTGGTGGTGACACCAAT
TTAGCACCCTTTGATTCTGTCACTCCAACTAAATTTGACAACAATTATTATAAGGACCTTATTGCTAATAAAGGTCTTCTACATTCTGATCAAGTTCTTTTCAATGGTGGTGGTTCTCAA
ATTTCTTTGGTTAGGAAGTATAGTAGAGATGGTGCTGCTTTTTCTAGAGACTTTGCTGCTGCTATGGTGAAGATGAGTAAAATTAGTCCTCTTACTGGGACTAATGGTGAGATCAGAAAG
AATTGCAGGATTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCTTGATTAAATTCTTTGTTACACTCTCTATATTTTCTCTCTTAGCTTGTTCAACCATTAATGCACAACTTTCTCCGAACTTTTATGCAAAAACTTGCTCTAATCTCCAAACC
ATTGTGCGCAATGAAATGATCAAAGTTATCCAAAAGGAAGCCCGGATGGGGGCTTCTATACTTCGATTGTTCTTCCATGATTGCTTTGTAAAT
GGATGCGATGCATCAATCTTATTGGAT
GACAAAGGAACATTTGTCGGTGAGAAAAATTCTGGACCTAACCAAGGTTCAGCTAGGGGTTTTGAAGTGATTGATACAATTAAAACCAGTGTTGAAACTGCTTGCAAAGCCACCGTCTCT
TGTGCTGATATTCTTGCACTTGCAACTAGAGATGGAATTGCATTG
CTTGGAGGACCCTCATGGGCAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGTCAAAGTGCAGCAAATAGC
CAAATCCCTGGACCATCTTCTGACCTATCGACACTCACTAGAATGTTTCAAAACAAAAGTCTAACATTAAATGACCTTACAGTCCTATCTGGTGCACACACCATAGGGCAAACTGAGTGT
CAATTTTTCAGAAATCGCATACACAATGAAGCCAACATTGACAGAAACTTGGCTACCTTAAGAAAAAGAAATTGCCCTACCTCTGGTGGTGACACCAATTTAGCACCCTTTGATTCTGTC
ACTCCAACTAAATTTGACAACAATTATTATAAGGACCTTATTGCTAATAAAGGTCTTCTACATTCTGATCAAGTTCTTTTCAATGGTGGTGGTTCTCAAATTTCTTTGGTTAGGAAGTAT
AGTAGAGATGGTGCTGCTTTTTCTAGAGACTTTGCTGCTGCTATGGTGAAGATGAGTAAAATTAGTCCTCTTACTGGGACTAATGGTGAGATCAGAAAGAATTGCAGGATTGTGAATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGATTCACAA TTCACACACT TCCTTTGCTT CCCTCCATTG GTAGCTTCAA GCTAGATAAT TAATGGCCAC CTTGATTAAA TTCTTTGTTA CACTCTCTAT ATTTTCTCTC TTAGCTTGTT  CAACCATTAA TGCACAACTT TCTCCGAACT TTTATGCAAA AACTTGCTCT AATCTCCAAA CCATTGTGCG CAATGAAATG ATCAAAGTTA TCCAAAAGGA AGCCCGGATG GGGGCTTCTA  TACTTCGATT GTTCTTCCAT GATTGCTTTG TAAATGGATG CGATGCATCA ATCTTATTGG ATGACAAAGG AACATTTGTC GGTGAGAAAA ATTCTGGACC TAACCAAGGT TCAGCTAGGG  GTTTTGAAGT GATTGATACA ATTAAAACCA GTGTTGAAAC TGCTTGCAAA GCCACCGTCT CTTGTGCTGA TATTCTTGCA CTTGCAACTA GAGATGGAAT TGCATTGCTT GGAGGACCCT  CATGGGCAGT ACCACTTGGA AGAAGAGATG CAAGAACAGC AAGTCAAAGT GCAGCAAATA GCCAAATCCC TGGACCATCT TCTGACCTAT CGACACTCAC TAGAATGTTT CAAAACAAAA  GTCTAACATT AAATGACCTT ACAGTCCTAT CTGGTGCACA CACCATAGGG CAAACTGAGT GTCAATTTTT CAGAAATCGC ATACACAATG AAGCCAACAT TGACAGAAAC TTGGCTACCT  TAAGAAAAAG AAATTGCCCT ACCTCTGGTG GTGACACCAA TTTAGCACCC TTTGATTCTG TCACTCCAAC TAAATTTGAC AACAATTATT ATAAGGACCT TATTGCTAAT AAAGGTCTTC  TACATTCTGA TCAAGTTCTT TTCAATGGTG GTGGTTCTCA AATTTCTTTG GTTAGGAAGT ATAGTAGAGA TGGTGCTGCT TTTTCTAGAG ACTTTGCTGC TGCTATGGTG AAGATGAGTA  AAATTAGTCC TCTTACTGGG ACTAATGGTG AGATCAGAAA GAATTGCAGG ATTGTGAATT GATTTTGGTT TTTTGTTTAT TATTATTTTG TTGTTTATGT AATTTTGTGA GACTAATAAT  TTGAGGGCAT ATCAGCAATT TAATAAATAT TGTGTGGAGA TTTTTGAGAG ATTGTTTAAT TACAGGGTCT AGGTCATAAA GGTTGACTAG ATCTTGGACA CATTGATAAT TTGTAGTATT 
GTTGGTGCTT CTTCAATTTG ATATTGTAAT GTTCTAAGTT TTATGATGGA TTCAAATTTG ACATTGTTTT ACTTCTAAAT TT 

Retrieve as FASTA