Entry information : NtPrx09-1A ( NtPrx09a)
Entry ID 3701
Creation 2010-02-11 (Christophe Dunand)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-16 (Achraf Jemmat)
Peroxidase information: NtPrx09-1A ( NtPrx09a)
Name (synonym) NtPrx09-1A ( NtPrx09a)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Nicotiana
Organism Nicotiana tabacum    [TaxId: 4097 ]
Cellular localisation N/D
Tissue types Cell culture
Flowers
Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NtPrx09-1A
start..stop
S start..stop
NtPrx09-1B 620 0 1..324 1..324
NtoPrx01 619 0 1..324 1..324
LePrx05 544 0 1..324 1..325
StPrx20 536 0 1..324 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 316..522 207 N° 2 911..1096 186 N° 3 1585..1750 166 N° 4 2197..2612 416
join(316..522,911..1096,1585..1750,2197..2612)


exon

Literature and cross-references NtPrx09-1A ( NtPrx09a)
Literature Osakabe K., Kawai S., Katayama Y., Morohoshi N. Nucleotide sequence for the genomic DNA encoding the anionic peroxidase gene from Nicotiana tabacum. Submitted (JUN-1992)
Protein ref. UniProtKB:   Q42964 [Incorrect splicing]
DNA ref. GenBank:   D11396.1 (316..2612) [Incorrect splicing]
EST ref. GenBank:   EB439200.1 [5' end]   FG637828.1 [3' end]
Cluster/Prediction ref. UniGene:   Nta.6928
Protein sequence: NtPrx09-1A ( NtPrx09a)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   34602.9 (32243.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.45 (4.39) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFFRFVGAILFLVAIFGASNAQLSATFYDCTCPNVTSIVRGVMEQRQRTDARAGAKIIRLHFHDCFVNGCDGSILLDTDGIQTEKDAIPNVGAGGFDIVDDIKTALENVCPGVVSCADILALASEIGVALAGGPCWQVLFGRRDSLTANRSGANSDIPSPFETLAVMTPQFTNKGMDLTDLVALSGAHTFGRARCGTFEQRLFNFSGSGNPDPTVDATFLQTLQGICPQGGNNGNTFTNLDISTPNDFDNDYFTNLQNNQGLLQTDQELFSTSGSATIAIVNRYAGSQSQFFDDFICSMIKLGNISPLTGTNGEIRKDCKRVN

Retrieve as FASTA  
Remarks Complete sequence from 1 cDNA, 2 ESTs and DNA (3 introns). Unigene compiles ESTs from both alleles. Cultivar="K326".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTTTTTAGATTTGTTGGTGCAATTCTTTTCTTGGTTGCAATTTTTGGAGCATCAAATGCTCAATTAAGTGCAACATTTTATGATTGCACTTGCCCTAATGTTACAAGTATTGTA
CGTGGTGTTATGGAACAAAGGCAACGTACTGATGCTCGAGCTGGTGCTAAAATTATTCGTCTTCATTTCCATGATTGTTTTGTTAAT
GTAATAACCTGACCCTTAGAACTTTTTCTAACC
TATGTTTTCATGCATGTTTATGTGTATTGAAGAACTACATCACGTTACGGAGCATAAATAATATATACTGACAGTGTAAAGATCTTTTATCATATTAGTGCAGCTTATAACATGTACTGG
ATATATATAGTGACGGTCTACAAATCTTTTACCATATCAGTGTAGCATGATTGTAGGTTAGTTACCATTTTTACTGTTATAGTGGGTATAACATTTTGTGATTTTACTGTGATAGAAAGT
CAAGTTCACTTTCTTTAATGTGTATATGTGCACAGGGTTGTGACTTTACTGTTATACTGTGAGAAAAAGTTCAGTGACCAAACGTGAAATTAACCGTATATATATATTTGCACAGGGTTG
TGATGGATCAATTTTGTTAGACACAGATGGGATACAAACTGAGAAAGATGCAATTCCTAATGTAGGTGCAGGAGGATTTGATATTGTTGATGATATTAAAACTGCATTAGAGAATGTATG
CCCTGGTGTTGTATCTTGTGCAGATATTTTAGCCCTTGCATCTGAAATTGGAGTTGCCTTG
GTAAGAGATTACAAATATGACATTTTCATAGATCTTGCTTAATTAATTAATTATTGATT
TTCTCCCCTTTTTCAGTTGTTGAAGTCTTTCTTAACTATTTAATTATTTATGATTTACTAATAAGATTAGCTTAAAAATATTTGAAAATCATCTTGGCTCTAAAAGCTAACAACATGGCC
TTTATTTTATGATATAGGCAGAGCGGAGCCAGGATTTCAAGTTTATGGGTTTGAGATTCTAATCATTTTAAGTTACTGGGTTTTAAATTAATAATTTACATATATTTAATGGAGTTTTTA
AGACAAAACAAGGTTCGAATTAAAATTACTGGATTCGACCGAACCTGCTCTCGGCACTCTAACTCCGCCCTTGAATTTAAGGCACATTCGAGAGAATTACCACTTAAATATTTTAAAGAC
AACTAGGATTTTATCACTAATTTAAGCATTATATATATACTGACAGTGTAAAAAATGTTACGTTATCAGGCTGGAGGTCCATGCTGGCAAGTACTTTTTGGCAGAAGAGATAGCTTAACA
GCAAACCGATCTGGAGCTAATAGTGATATTCCTAGCCCCTTTGAAACCCTTGCTGTAATGACGCCACAATTCACCAACAAGGGAATGGATTTAACTGATCTTGTTGCTCTATCTG
GTAAA
GAATTTTTGCACTATCAGTATACTTTAATTTGTTGAAAAACACCCAACATGGGTGTGTTAGCCATAAACTTGATCAAAAAAGAAAAAAAAAATTGTTATAATAGGTAATACGTTTTATTT
TACAGGTTACTAATCTCACTTTTTATAAGCAGTACATGTAACTATCTTTTAAACGACTTGGTTATGAAAAAAACTTACCTGTCATTATATAGGAGTTAATTTGAGATTGAAACGTATTTG
ATTGATTTCACGTTAACAACAGTTTCTCTAAGGGTAAAGATTTAACATGTTCTAGCATGTTAGTACTTACCATTTGTACTAGGTTACCGATAAGTATTTATTACTGCATAAAAATTACAT
GCAGTTACCTCTTAAATAATCTGATTGTATAAGTTTTCACTCTGTTTACACATAAAACTTAAACGCATTCTGAATGTGTAGGTGCACACACATTTGGAAGAGCAAGATGTGGTACTTTTG
AACAACGTCTCTTTAACTTCAGTGGCAGTGGTAATCCTGATCCAACCGTAGACGCTACATTTTTACAAACATTACAGGGAATTTGTCCTCAAGGTGGAAATAATGGCAATACTTTTACAA
ATCTTGATATATCAACTCCTAATGATTTTGATAATGACTATTTCACTAATCTTCAAAATAATCAAGGACTTCTTCAAACTGATCAAGAGTTGTTTTCTACATCTGGATCTGCTACAATTG
CTATAGTGAATCGTTATGCTGGTAGTCAAAGTCAGTTTTTTGATGATTTTATTTGCTCGATGATTAAATTGGGTAATATAAGTCCATTAACTGGTACTAATGGAGAGATTAGGAAAGATT
GCAAGAGGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTTTTTAGATTTGTTGGTGCAATTCTTTTCTTGGTTGCAATTTTTGGAGCATCAAATGCTCAATTAAGTGCAACATTTTATGATTGCACTTGCCCTAATGTTACAAGTATTGTA
CGTGGTGTTATGGAACAAAGGCAACGTACTGATGCTCGAGCTGGTGCTAAAATTATTCGTCTTCATTTCCATGATTGTTTTGTTAAT
GGTTGTGATGGATCAATTTTGTTAGACACAGAT
GGGATACAAACTGAGAAAGATGCAATTCCTAATGTAGGTGCAGGAGGATTTGATATTGTTGATGATATTAAAACTGCATTAGAGAATGTATGCCCTGGTGTTGTATCTTGTGCAGATATT
TTAGCCCTTGCATCTGAAATTGGAGTTGCCTTG
GCTGGAGGTCCATGCTGGCAAGTACTTTTTGGCAGAAGAGATAGCTTAACAGCAAACCGATCTGGAGCTAATAGTGATATTCCTAGC
CCCTTTGAAACCCTTGCTGTAATGACGCCACAATTCACCAACAAGGGAATGGATTTAACTGATCTTGTTGCTCTATCTG
GTGCACACACATTTGGAAGAGCAAGATGTGGTACTTTTGAA
CAACGTCTCTTTAACTTCAGTGGCAGTGGTAATCCTGATCCAACCGTAGACGCTACATTTTTACAAACATTACAGGGAATTTGTCCTCAAGGTGGAAATAATGGCAATACTTTTACAAAT
CTTGATATATCAACTCCTAATGATTTTGATAATGACTATTTCACTAATCTTCAAAATAATCAAGGACTTCTTCAAACTGATCAAGAGTTGTTTTCTACATCTGGATCTGCTACAATTGCT
ATAGTGAATCGTTATGCTGGTAGTCAAAGTCAGTTTTTTGATGATTTTATTTGCTCGATGATTAAATTGGGTAATATAAGTCCATTAACTGGTACTAATGGAGAGATTAGGAAAGATTGC
AAGAGGGTTAATTAA

Retrieve as FASTA