Entry information : MtPrx47 (Medtr4g132110.1[4.0] / Medtr4g132110.2[3.5] / Medtr8g146760.2[3.0])
Entry ID 371
Creation 2006-02-17 (Christophe Dunand)
Last sequence changes 2006-02-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtPrx47 (Medtr4g132110.1[4.0] / Medtr4g132110.2[3.5] / Medtr8g146760.2[3.0])
Name (synonym) MtPrx47 (Medtr4g132110.1[4.0] / Medtr4g132110.2[3.5] / Medtr8g146760.2[3.0])
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx47
start..stop
S start..stop
MsPrx10 674 0 1..335 1..335
CarPrx01 662 0 1..334 1..334
GmPrx02 605 0 1..335 1..331
PvPrx11 602 0 1..335 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55186327..55186557 231 N° 2 55186032..55186220 189 N° 3 55185506..55185671 166 N° 4 55184651..55185072 422
complement(join(55184651..55185072,55185506..55185671,55186032..55186220,5518632 7..55186557))


exon

Literature and cross-references MtPrx47 (Medtr4g132110.1[4.0] / Medtr4g132110.2[3.5] / Medtr8g146760.2[3.0])
Literature Grusak,M.A. et al., unpublished
DNA ref. Phytozome 12:   chr4 (55186557..55184651)
Cluster/Prediction ref. Phytozome Gene 12:   31108263 UniGene:   Mtr.3399
Omic ref. Gene atlas:   Mtr.12276.1.S1_at   Mtr.7102.1.S1_s_at Legoo:   Mtr.12276.1.S1_at   Mtr.7102.1.S1_s_at
Protein sequence: MtPrx47 (Medtr4g132110.1[4.0] / Medtr4g132110.2[3.5] / Medtr8g146760.2[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (309)
PWM (Da):   %s   37789.43 (34932.9)  
PI (pH):   %s   8.7 (8.54) Peptide Signal:   %s   cut: 27 range:27-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPNKAFLFLALLSFSPQLFFIVSSAAEDNGLVMNYYKEACPQAEEIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLTSTRRSLSEQEHDRSFGLRNFRYIDTIKEAVERECPGVVSCSDILVLSAREGIVSLGGPYIPLKTGRRDGRKSRVDLLEAYLPDHNESISAVLDKFGAMGIDTPGVVALLGAHSVGRTHCTKLVHRLYPEVDPALNPEHIPHMLKKCPDSIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLIVDHQLAHDKRTKPYVKKMAKSQEYFFKEFSRAITLLSENNPLTGTKGEIRKQCSVSNKQHHEEP

Retrieve as FASTA  
Remarks Complete sequence from 382 ESTs and from genomic (chromo 4, 3 introns). Two other incorrect transcripts predicted by Phytozome
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCAAACAAAGCTTTCCTCTTTTTAGCTCTTTTGTCCTTTTCTCCACAACTCTTCTTCATTGTTTCTTCTGCAGCAGAAGATAATGGCCTTGTTATGAATTACTACAAAGAAGCA
TGTCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAAAACACTGCTTTCTCTTGGCTCAGAAACATTTTCCATGACTGTGCTGTTCAG
GTAACTATA
ACTTTCTTTATGTCATGCTATTTATGTACACTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATGGTTTTGTTTCCTCTCTTGGTTGTGTTATAGAGTTGTGATGCTTCTTTGTTGCT
AACATCCACAAGAAGAAGCTTGTCTGAGCAAGAACACGACAGAAGCTTTGGTTTGAGGAATTTTAGGTACATTGATACCATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTTGTTTC
CTGTTCTGATATTCTTGTTCTTTCTGCAAGAGAAGGCATTGTTTCG
GTATAATTTCCTGTCCTTTCTCTTTTTGTTTTTGTTTCTGACTTTGTTTATCTTCATCTGGTTCTGGTGCATAC
TTTTTTAAGTAAAAACATGTTTTTTTAAGGACAAGGTTTTGCAGTTACTAATTATGTGCATATATCAAATTGGGTTATACATTGTATTTGTACATAAAACTAATACACAAAGCTGTTATA
TAATTTTGCATATTATTAAATTGAAGAGAGTAGTTGGAGGCTTAGATCTAGTCCAGATTTGTTTTGACTTTTGTTTAAGGACTGAACTTATTTTTTAAATAAATTCTAGTAATAGTTTAA
TTTATCCATTATTTGTTGAGCAAATGAGAAGTTAAAATTGATGCAGCTAGGAGGTCCATATATTCCTCTGAAAACAGGAAGAAGGGATGGTAGAAAGAGTAGAGTTGATCTGTTGGAGGC
ATACCTTCCTGACCACAATGAGTCCATTTCTGCTGTTCTTGACAAATTTGGTGCCATGGGAATTGACACTCCTGGAGTTGTTGCTTTGCTTG
GTATAATACCATACTAAACATCTTCTCC
ATAATTAATTAACTCATAAACATTATGCTATGTTCTCATTTTATTAAAATGGAAATCTTTCATTTTTACATCATATCTAATAAAAATAATGTAATGTCCTCAATCCTCATGGGTATGACT
CATCAGATAGATAAAGCCAAATTGTGGGGTCCTCAATCCTCATGACTCATCAGATTTTAATAGATAAAGCCAAATTGTAGTTTAGATCCGTTGCACGTTGCAACATGCTGAATAACCCTT
GGATTTGAATCCACGCATTCAGATCCAATGGTCATTTAATTTAAGGACTTTATTATTGTTAGAATTTGCGTTGAACTTAACTCATTTCTTACAAAATTGACTTGTGGAGCATGGACTATC
CATATCGTAATATATGGAGTATCATTCAATTATTTTGTTGAACAGGAGCACACAGTGTTGGTAGAACCCATTGTACAAAGTTGGTGCACCGTTTGTACCCCGAAGTTGATCCAGCTTTGA
ACCCAGAACACATTCCACACATGCTTAAAAAGTGCCCTGATTCAATCCCTGACCCTAAGGCAGTGCAGTACGTGAGAAACGACCGTGGCACGCCGATGATTCTAGATAACAACTACTACA
GAAATATCTTGGACAACAAGGGTCTTTTGATTGTGGATCATCAATTAGCACATGACAAGAGGACTAAGCCTTATGTGAAGAAAATGGCCAAGAGCCAAGAATATTTCTTCAAGGAGTTTT
CTAGAGCTATTACATTGCTTTCTGAAAACAATCCTCTTACTGGCACAAAGGGTGAGATCAGAAAGCAATGCAGTGTTTCCAACAAGCAGCACCATGAAGAGCCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCAAACAAAGCTTTCCTCTTTTTAGCTCTTTTGTCCTTTTCTCCACAACTCTTCTTCATTGTTTCTTCTGCAGCAGAAGATAATGGCCTTGTTATGAATTACTACAAAGAAGCA
TGTCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCTACAAACGCCACAAAAACACTGCTTTCTCTTGGCTCAGAAACATTTTCCATGACTGTGCTGTTCAG
AGTTGTGAT
GCTTCTTTGTTGCTAACATCCACAAGAAGAAGCTTGTCTGAGCAAGAACACGACAGAAGCTTTGGTTTGAGGAATTTTAGGTACATTGATACCATCAAAGAAGCTGTTGAAAGAGAGTGT
CCTGGAGTTGTTTCCTGTTCTGATATTCTTGTTCTTTCTGCAAGAGAAGGCATTGTTTCG
CTAGGAGGTCCATATATTCCTCTGAAAACAGGAAGAAGGGATGGTAGAAAGAGTAGAGTT
GATCTGTTGGAGGCATACCTTCCTGACCACAATGAGTCCATTTCTGCTGTTCTTGACAAATTTGGTGCCATGGGAATTGACACTCCTGGAGTTGTTGCTTTGCTTG
GAGCACACAGTGTT
GGTAGAACCCATTGTACAAAGTTGGTGCACCGTTTGTACCCCGAAGTTGATCCAGCTTTGAACCCAGAACACATTCCACACATGCTTAAAAAGTGCCCTGATTCAATCCCTGACCCTAAG
GCAGTGCAGTACGTGAGAAACGACCGTGGCACGCCGATGATTCTAGATAACAACTACTACAGAAATATCTTGGACAACAAGGGTCTTTTGATTGTGGATCATCAATTAGCACATGACAAG
AGGACTAAGCCTTATGTGAAGAAAATGGCCAAGAGCCAAGAATATTTCTTCAAGGAGTTTTCTAGAGCTATTACATTGCTTTCTGAAAACAATCCTCTTACTGGCACAAAGGGTGAGATC
AGAAAGCAATGCAGTGTTTCCAACAAGCAGCACCATGAAGAGCCTTGA

Retrieve as FASTA