Entry information : MtPrx49 (Medtr4g029180.1[4.0])
Entry ID 373
Creation 2008-12-07 (Christophe Dunand)
Last sequence changes 2014-07-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-07-30 (Christophe Dunand)
Peroxidase information: MtPrx49 (Medtr4g029180.1[4.0])
Name (synonym) MtPrx49 (Medtr4g029180.1[4.0])
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots nodules
Inducers Nodulation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx49
start..stop
S start..stop
MtPrx81 596 0 1..321 1..321
GmPrx96 488 8e-176 1..321 1..319
GmPrx97 474 2e-170 1..321 1..319
GmPrx129 474 3e-170 1..321 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10067892..10068107 216 N° 2 10067323..10067517 195 N° 3 10066073..10066627 555  
complement(join(10066073..10066627,10067323..10067517,10067892..10068107))


exon

Literature and cross-references MtPrx49 (Medtr4g029180.1[4.0])
Literature Journet,E.P. et al., unpublished
DNA ref. Phytozome 11:   chr4 (10068107..10066073)
EST ref. GenBank:   GE351905 [3' end]
Cluster/Prediction ref. Phytozome Gene 11:   31110628 UniGene:   Mtr.10197 [5' end]
Omic ref. Gene atlas:   Mtr.10958.1.S1_at Legoo:   Mtr.10958.1.S1_at
Protein sequence: MtPrx49 (Medtr4g029180.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 321 (296)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
35304.98 (32390.5)  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.72 (9.55) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSHRFFSKFFYTLVLATLTTTTFSALTTNYYDYTCPNALSTIKSVVKAAVQRENRMGASLLRLHFHDCFVNGCDGSILLDSTPSMDSEKNANPNINSARGFEVVDEIKDAVDKACGKPVVSCADILAIAARDSVVALGGPSWKVKLGRRDSKTASRADADSGNIPGPAFSLSQLIKNFDNQGLNEKDLVALSGAHTIGFSRCFLFRDRIYKDNNINAYFAKQLQNVCPREGGDSNLAPLDSVTSAKFDVAYYSQLIKKKGLLHSDQELLKGGYTGALVRKYRRDTRTFYKDFAKSMIKMGNIKPLTGKQGEVRYNCRRAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, introns 1 and 2) and 9 ESTs. Cultivar="A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCACATAGGTTTTTCTCAAAGTTCTTCTACACATTAGTGTTAGCAACTCTTACAACAACAACATTTTCAGCACTCACAACAAATTACTATGATTACACATGCCCTAATGCTTTG
AGCACTATTAAAAGTGTTGTTAAAGCTGCAGTTCAAAGAGAGAACCGTATGGGTGCTTCTTTACTACGCTTGCACTTTCATGATTGCTTTGTTAAT
GTAAGAATATTATCATCATTTCTC
TGTGTGTATACATAATATTATTACTTCAAAAAAAAATTATATCAAAATTTTCAATTTGTCTCTAAATCATACTTCTAGAAATATTAAAATGACAAAAATTATTTACATAAATAATAAACT
AACTCTCTATTTCTTTCATCACAAAATTTATAATGTTCTCTAATTTTTTTTTTAGTAATGATCTATCATAAATAGTGACAAATTAATTTTAGTTACTTTTCTAAATGAATCAATAAATTT
ATTTTAATGATTAATTTATAAACTGATTAGACTGATAATATGAAAATTAGTCGAGAAATTAAACTAATTAAACTAATTTATTTTAATGATTAATTTATGGTGTGATTCAGGGTTGTGATG
GTTCAATTCTTCTAGACTCTACACCTTCAATGGACAGTGAAAAAAATGCAAATCCAAATATAAATTCAGCAAGAGGATTTGAAGTTGTTGATGAGATTAAGGATGCTGTTGATAAAGCAT
GTGGAAAACCAGTTGTTTCTTGTGCAGACATTTTGGCCATAGCTGCAAGAGACTCTGTCGTTGCG
GTTAGTAATAATATTCTACATTTTAACTCCTTCAAAACAAAAATATTCTACATTT
TAATATATATATATATATATATTTTATTTTATTTTGAATTAGTCCGTAATTTTCAAACAGAATTAGTCAGCATGGTTGGTTAATTTTTTTGATCAAATGAATAAAATAAAGTTAATAAAA
GGAAGTTACTAAGAGTTAAGCATTTATATATGAAATTTTCTAATTTATACCACCAACATTGAATATATCAAAATTAAAATGCCCAAAGTTGTGTAACTTGCTAATAAATTTATTCTAACG
ATATGACTGAGTCGATTTTACTTATATTAGTATTTACTATTTGAATGTATCAAAGTAAAGCCACACAAGTTACATGCTACAAATATTTTTTTGGTAAACTAATTATTTTTGTTGATAGAG
TAAACTAAAATATTTTAGACGTATAAAAAATAATATCACGAGATAATTGAGATATTTTTTTTTTTTCATCGATATTTTCTTATATTGAATATAACTTGAGACTCAAGTATCTATAACTCA
TGTCATTCCATGCATGATTCCTTCATTAATTCCATATGTGTGTATTAGAGATTTTTCAAATCCTACAAAAGCTTCTTCAATATACAAAAAAGGACAAATAAAAATGTTGCTTGCATAACA
CGAAATTTAAATTGAAATTTACCATTATATATGGATGCAGTTAGGAGGACCATCATGGAAAGTGAAACTAGGAAGAAGAGACTCAAAGACAGCAAGTCGTGCCGATGCAGATTCAGGCAA
TATCCCCGGACCAGCATTCAGTCTTTCTCAACTCATCAAAAACTTCGACAATCAAGGCCTAAACGAAAAAGACCTCGTTGCCCTATCTGGAGCACACACTATTGGATTCTCGCGTTGTTT
TTTATTTAGAGACCGAATCTACAAAGACAACAACATCAATGCATATTTCGCAAAACAACTTCAAAACGTTTGCCCTAGAGAAGGCGGAGACTCCAACCTCGCTCCTCTCGACAGTGTAAC
ATCAGCGAAATTTGATGTGGCTTATTACTCGCAATTGATTAAAAAGAAAGGGCTTCTTCATTCTGATCAAGAATTGTTGAAGGGTGGTTATACTGGAGCTTTGGTTAGAAAATATAGGCG
TGATACAAGAACTTTCTATAAGGACTTTGCAAAATCTATGATTAAGATGGGAAATATTAAGCCACTTACTGGGAAACAGGGTGAAGTTCGTTACAATTGTAGGAGAGCCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCACATAGGTTTTTCTCAAAGTTCTTCTACACATTAGTGTTAGCAACTCTTACAACAACAACATTTTCAGCACTCACAACAAATTACTATGATTACACATGCCCTAATGCTTTG
AGCACTATTAAAAGTGTTGTTAAAGCTGCAGTTCAAAGAGAGAACCGTATGGGTGCTTCTTTACTACGCTTGCACTTTCATGATTGCTTTGTTAAT
GGTTGTGATGGTTCAATTCTTCTA
GACTCTACACCTTCAATGGACAGTGAAAAAAATGCAAATCCAAATATAAATTCAGCAAGAGGATTTGAAGTTGTTGATGAGATTAAGGATGCTGTTGATAAAGCATGTGGAAAACCAGTT
GTTTCTTGTGCAGACATTTTGGCCATAGCTGCAAGAGACTCTGTCGTTGCG
TTAGGAGGACCATCATGGAAAGTGAAACTAGGAAGAAGAGACTCAAAGACAGCAAGTCGTGCCGATGCA
GATTCAGGCAATATCCCCGGACCAGCATTCAGTCTTTCTCAACTCATCAAAAACTTCGACAATCAAGGCCTAAACGAAAAAGACCTCGTTGCCCTATCTGGAGCACACACTATTGGATTC
TCGCGTTGTTTTTTATTTAGAGACCGAATCTACAAAGACAACAACATCAATGCATATTTCGCAAAACAACTTCAAAACGTTTGCCCTAGAGAAGGCGGAGACTCCAACCTCGCTCCTCTC
GACAGTGTAACATCAGCGAAATTTGATGTGGCTTATTACTCGCAATTGATTAAAAAGAAAGGGCTTCTTCATTCTGATCAAGAATTGTTGAAGGGTGGTTATACTGGAGCTTTGGTTAGA
AAATATAGGCGTGATACAAGAACTTTCTATAAGGACTTTGCAAAATCTATGATTAAGATGGGAAATATTAAGCCACTTACTGGGAAACAGGGTGAAGTTCGTTACAATTGTAGGAGAGCC
AATTAA

Retrieve as FASTA