Entry information : MtPrx54 (Medtr3g094650.1[4.0] / Medtr3g094650.1[3.5] / Medtr3g145050.1[3.0])
Entry ID 379
Creation 2008-12-31 (Christophe Dunand)
Last sequence changes 2008-12-31 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx54 (Medtr3g094650.1[4.0] / Medtr3g094650.1[3.5] / Medtr3g145050.1[3.0])
Name (synonym) MtPrx54 (Medtr3g094650.1[4.0] / Medtr3g094650.1[3.5] / Medtr3g145050.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Leaves
Stems
Trichomes
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx54
start..stop
S start..stop
MsPrx05 567 0 1..293 1..293
MtPrx98 558 0 1..322 1..322
MtPrx84 539 0 1..322 1..322
GmPrx328 511 0 6..322 5..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43186587..43186805 219 N° 2 43188853..43189044 192 N° 3 43189152..43189317 166 N° 4 43189917..43190308 392
join(43186587..43186805,43188853..43189044,43189152..43189317,43189917..43190308 )


exon

Literature and cross-references MtPrx54 (Medtr3g094650.1[4.0] / Medtr3g094650.1[3.5] / Medtr3g145050.1[3.0])
Literature Liu,J. et al., unpublished.
DNA ref. Phytozome 12:   chr3 (43186587..43190308)
Cluster/Prediction ref. Phytozome Gene 12:   31060968
Omic ref. Gene atlas:   Mtr.38808.1.S1_at Legoo:   Mtr.38808.1.S1_at
Protein sequence: MtPrx54 (Medtr3g094650.1[4.0] / Medtr3g094650.1[3.5] / Medtr3g145050.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (296)
PWM (Da):   %s   34597.37 (31833.9) Transmb domain:   %s   i12-34o
PI (pH):   %s   8.7 (8.64) Peptide Signal:   %s   cut: 27 range:27-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPLSCSRITMFSLVLFVLIIGSVNAQLSTNFYSKTCPKLSSIVQRQVQSAISKEARIGASILRLFFHDCFVNGCDGSILLDDTSNFTGEKNALPNKNSVRGFDVIDNIKTAVENVCPGVVSCADILAIAATDSVAILGGPTWNVKLGRRDATTASQSDANTAIPRPTSNLNILTSMFKNVGLSTKDLVALSGAHTIGQARCTTFRVRIYNETNIDTSFASTRQSNCPKTSGSGDNNLAPLDLHTPTSFDNCYYRNLVQNKGLLHSDQQLFNGGSTNSIVSGYFNNQNSFFSDFATAMIKMGDIKPLTGSNGEIRKNCRKPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTTAAGTTGTTCTAGAATAACAATGTTCAGTTTGGTTCTATTTGTCCTCATAATAGGGAGTGTCAATGCACAACTCTCTACAAACTTTTACTCAAAAACTTGTCCCAAACTC
TCTTCCATTGTCCAACGTCAAGTGCAATCCGCCATATCAAAGGAGGCACGAATTGGTGCTTCTATCCTCCGCTTGTTCTTCCACGATTGCTTTGTCAAT
GTAAGCCTCAACATGTTTGAC
CAATTTCATTTATAGCACCACATATTTTTCAATACACTTTCTTTATTGATACTATTATATTTTTTTGGTGTTGACCGGGTTGCATATATAACATTATGTTTCAGATTATTTGTATAATAT
TCATTTGAAATTCATACTTCCTCCGTCCCTATATGTAAACATCCATTTGATTTTACTTTTGTCCTTAAATATAAACCCCTTTTCAATTTACTAGATGCATTTATTATTTTTTTCCTAAAC
ATACCCTGAATTAATATCACTATCTTGTCTTGAAATATGAAAAGTCAACACATACAAACAAAGGACAATTTCGTAATATTAATACACAAAACAGACACATTAATTACATTGACAACTTTT
TTTAAGAAATATGAAAAAGGCAATGAGTGACTACATTAACGGACGGAGGGAGTATATCTCAGAAATAACAAAATAAACAAAGAATTACTCATATTATAACCCAAAATTTATTAAATGAAC
TATTAATATCTACATAAAATATAAAATATAATATAATATCATAGTTGTGTAAATTAAAATAATAAAAAATATGTGTTTAGAGTGAATAGAATTGACACATATAAGGAAAAAATTTATATA
TGAAATTGATTAAAATAAGTAATTTAATTTTAATCAGATAATTATTTCAATTTTCTCTATCAATTTAATATTTTAAAAATGAATTATCCATTAAAAAAATTTGTTACAAAATTTTTAAGT
GAACTCCGGGTGCTCACCATATCAGGGCAAGCCTCAAGTTCAAAGAAGGTTTACATAGGTAATTAAATATCACCCACCAAAGATGTTCTCACATCGACAATGGTAATTAAACTCACGACC
TTGCGTGTCAATCAACTTTTTATTAAATGAGTCAACCTTCATTGACAGTGTCTATTAAATTTGATCAAAGCTATATGCTTACTTAAATTGGCGTTTAATTAAGAATACAACTAAGAAACA
AATAAAAAATTAAAATTAAAATGTAGGATTATATTTAAAAAAAACAAAAAAAAATTGTGTCTGCGTATATATAATAATAATAATAACTAAATAAATAATATTAATATACTTGTCACTTAA
AAGCACGATGATGGTAAGATATCTCTTCAAGTTACTTAATTAGAAGTTATGAGTTATTGGATTTATTCCAAACCCATGAATGCAATAGTCTTAAGTTGAACTTTGCCAAACATTATGGTC
ATATCCTATTGAGAGATTAATCTCTGCTGTTGCAGCAGAGAAAATTCGGTTCATGCAAAAGATAAAATAGTCCCTTCAAAAGAATAATAGCTAGTAATAGTAAGAATTATTAGGGATGAC
AAACAACATATAAGCATGATATGCAAAGATAAAATCCACTATGGGTATATTTTTTTTTTTTCGTTCACAAATCATCATGGGCATAAAGTGGATAGTTTAACTACTACATGTACATAAAAT
ATAGTTTCGCTCAAAAAAAAAGTACATAAAATATAGTTATATTTTAATTACTCTCAACTAATTGGTAGAAACAACAAGTAATTATATTCGTACTCAAAGTTTATAATGATAATTTAGATA
TCTAGTTTGTTGAGCTAGTTATTCTACATAAAAAATCATTTTAATTAAAAAATATGTTAGTAGCAAATGTGCATAATAAATTAAAAACAAAATTAAATAATATTTTCCTTCAAAAAAAAA
AAATATTTAAAAAAAATTATTGAATGAAATATAAACATAAATAAAATATTTAGTGGATAAGATCAGTACAATATATAAAGTTATTGAGATAATTATGCCAAATAAAATACTGATTTTAAA
AAATAGAAAAAATAGTAAAAATATTGAAAATAAAGGTGGAAGTGACATGTGGCATAAAACCTTACTTTATATACTATTATTGATTTAAAACGGCGCTATTTTACCATTGTCTTCCGGAAG
ATTTGAATTTTATCCACCTAGATACGAGATGAAATTCTTATTACTTTAGTTGATGTCTCATCAGCACAATGAGTAAACTATGATATATTTTATTTGCTAATTATAGGGGTGCGATGGGTC
AATTCTACTAGATGACACATCAAACTTTACCGGAGAGAAGAACGCACTCCCGAATAAGAACTCTGTTCGAGGATTCGATGTCATTGACAACATAAAGACGGCGGTAGAGAACGTATGCCC
CGGAGTTGTATCATGTGCTGATATCCTTGCCATTGCTGCCACAGACTCCGTTGCAATT
GTAAGTATGTTGTAGTCATATATCAATGAATTAATTAACCAATCAAAATATAGAACACTAAC
CATGCAAATGTAAATTTGTTGTCTTGCTTTTAATTTACATGATAGCTTGGTGGCCCAACCTGGAATGTAAAACTTGGAAGAAGAGATGCCACAACTGCTAGTCAATCTGATGCGAACACT
GCCATCCCAAGACCAACTTCCAACCTTAATATACTCACCTCAATGTTTAAGAATGTTGGTCTTTCCACCAAGGACTTAGTCGCATTGTCAG
GTACAATTCCATTGCTTTAGACATATACA
TATAGTTTTTTTACTTATATTTAATTCAAATATCTAATTTAAGTAAAATTACATAATTCGTTCATTAACTTAACTTCAAATAATACTTTCGTTCTTTATCTTATTTTCTCCATAAAGTAA
TATTTTTTATCTTTTATCGTTTTCTTTTTCCGATTTAATCTTTTATGTTATAAAATGTCAACAATGTTCTCTTTTTATGGGATTTTTTTTAATGAAATTTGGGTTTCTATGTTTGTAGGA
TGAAGATTTGGATGCGTTTATGAGTTTGATGAATTCTTTATAAGTTCTTTTTATGAATTTTTTTATTTTGTTTTCATAAAAAATGATAACAATGTTGACATTTTATAACATAACATAAAT
GACTAAATCGAAAAAAGAAAAAGATAAAGGAAGAAAGTGTTACCTGGTTATAGCATAAAAGATGAAATTGAGAAAAAATAAGATAAATGACGAAAGTGTTACATGAAATTAAGTTAATGG
TCGAGTTGTGTAATTTTGCCTATAATTTCTCAACTGGGAAGAACTAATAATTGTCAAATAACTAATTTGGTGTCTTAATTAATTGACTAGGTGCTCACACAATTGGACAAGCAAGGTGCA
CAACATTTAGGGTACGAATCTACAATGAGACCAACATAGATACTTCTTTTGCTAGCACAAGGCAATCTAATTGCCCAAAGACATCAGGATCAGGGGACAACAATTTGGCACCTCTTGATC
TCCATACTCCCACTTCTTTTGACAACTGCTACTACAGGAACCTTGTTCAAAACAAGGGTCTTCTTCATTCAGACCAACAACTTTTCAACGGCGGGTCCACTAACTCAATAGTGAGTGGCT
ATTTTAATAATCAAAACTCTTTTTTCTCTGATTTTGCCACTGCTATGATCAAGATGGGAGATATTAAGCCACTCACTGGATCAAATGGAGAGATTAGAAAGAACTGCAGAAAACCCAACT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCTTTAAGTTGTTCTAGAATAACAATGTTCAGTTTGGTTCTATTTGTCCTCATAATAGGGAGTGTCAATGCACAACTCTCTACAAACTTTTACTCAAAAACTTGTCCCAAACTC
TCTTCCATTGTCCAACGTCAAGTGCAATCCGCCATATCAAAGGAGGCACGAATTGGTGCTTCTATCCTCCGCTTGTTCTTCCACGATTGCTTTGTCAAT
GGGTGCGATGGGTCAATTCTA
CTAGATGACACATCAAACTTTACCGGAGAGAAGAACGCACTCCCGAATAAGAACTCTGTTCGAGGATTCGATGTCATTGACAACATAAAGACGGCGGTAGAGAACGTATGCCCCGGAGTT
GTATCATGTGCTGATATCCTTGCCATTGCTGCCACAGACTCCGTTGCAATT
CTTGGTGGCCCAACCTGGAATGTAAAACTTGGAAGAAGAGATGCCACAACTGCTAGTCAATCTGATGCG
AACACTGCCATCCCAAGACCAACTTCCAACCTTAATATACTCACCTCAATGTTTAAGAATGTTGGTCTTTCCACCAAGGACTTAGTCGCATTGTCAG
GTGCTCACACAATTGGACAAGCA
AGGTGCACAACATTTAGGGTACGAATCTACAATGAGACCAACATAGATACTTCTTTTGCTAGCACAAGGCAATCTAATTGCCCAAAGACATCAGGATCAGGGGACAACAATTTGGCACCT
CTTGATCTCCATACTCCCACTTCTTTTGACAACTGCTACTACAGGAACCTTGTTCAAAACAAGGGTCTTCTTCATTCAGACCAACAACTTTTCAACGGCGGGTCCACTAACTCAATAGTG
AGTGGCTATTTTAATAATCAAAACTCTTTTTTCTCTGATTTTGCCACTGCTATGATCAAGATGGGAGATATTAAGCCACTCACTGGATCAAATGGAGAGATTAGAAAGAACTGCAGAAAA
CCCAACTAA

Retrieve as FASTA