Entry information : MePrx10 (cassava4.1_029287m)
Entry ID 3804
Creation 2006-08-28 (Christophe Dunand)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx10 (cassava4.1_029287m)
Name (synonym) MePrx10 (cassava4.1_029287m)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx10
start..stop
S start..stop
RcPrx49 612 0 18..348 16..353
PtPrx07 583 0 23..347 15..344
CsPrx13 584 0 18..347 17..354
CppPrx08 580 0 20..347 18..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18338..18604 267 N° 2 17977..18177 201 N° 3 16499..17077 579  
complement(join(16499..17077,17977..18177,18338..18604))


exon

Literature and cross-references MePrx10 (cassava4.1_029287m)
Literature Pereira F., Erickson L., Goodwin P. Submitted (JUL-1998).
Protein ref. UniProtKB:   O82477
DNA ref. Phytozome 12:   scaffold06606 (18604..16499)
Protein sequence: MePrx10 (cassava4.1_029287m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349
PWM (Da):   %s   38297.78 Transmb domain:   %s   o10-32i
PI (pH):   %s   9.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPAPSSSSSVCLLLSLSFVFACLLIFLPISLAKTTNSTRLPRQLSINYYAKNCPQLEQLVGSVTSQQFKETPVSGPATIRLFFHDCFVEGCDASILISTKPGSKELAEKDAEDNKDLRVEGYESIRKAKALVESKCPGVVSCADILAIAARDYVHLAGGPYYQVKKGRWDGKISMASRVPYNLPQANSTIDQLLKLFNSKGLTPQDLVVLSGAHTIGFAHCKHFINRLYNYGGTKQPDPVIDPRLLKALRMSCPQFGGNEDIVAPFDVTTPFLFDHAYYGNLEAKLGLLASDQALFLDPRTKPLVQQLGTNKQKFFQAFSQAMDKMGSIGVKRGRRHGEKRRDCSIHGL

Retrieve as FASTA  
Remarks Complete sequence from genomic. Cultivar="MCo122".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCCCCTTCTTCTTCTTCTTCTGTTTGCCTTCTCCTCTCACTATCATTTGTTTTCGCTTGTTTGCTCATTTTCTTGCCAATTTCTCTAGCCAAAACCACCAACTCCACTCGCCTA
CCACGCCAACTTTCCATTAACTACTATGCAAAAAACTGTCCTCAACTTGAACAACTTGTTGGTTCAGTCACTTCCCAACAATTCAAAGAAACTCCAGTTTCAGGGCCAGCCACCATTCGC
CTATTCTTCCATGACTGCTTTGTAGAA
GTAATCTAAATTCTACACTATTTCTCCATGCATGCAAATTTTAGCCAAAATTTCCTCACATTTCAAGCAATTTATTCTCTGTCATCTTAATTA
GCAGATGCTAATTAGCTTTTGGTTTGCATTATAATTCTTTATTTTCTTTTTGGTTGGATTATTGAAGGGTTGTGATGCTTCTATCTTGATATCAACGAAGCCTGGAAGCAAAGAGTTGGC
AGAGAAGGATGCAGAAGATAACAAGGATTTGAGGGTGGAGGGATATGAGAGCATTAGAAAGGCTAAGGCATTGGTGGAGAGCAAGTGTCCTGGTGTTGTATCCTGTGCAGATATTCTTGC
AATTGCTGCCAGAGATTATGTCCACCTG
GTATGCCTCTGCATTTCAATTCTTGATATCCCCTACTCAATCCTTAATTAACTATTTCAAACTCTAGATCTTATCCCACTCAATCAAAACTT
ATTAACAATTTGGAATATATTGATGGTAACAAAGTCCTATAAATAATCCAAAGCATAGGGCTGGTTTGTTGATATAAGGGAAATCAAATTTCTTGACTGTAGGTGAAAATATATGTTGGG
GTGCTCATACTCATAATGCTTCCAAAGTAGAAAGGTGGAAAAAGGAAGATTGGTTTTGTCATTTTTGACAAAGTATTTAGAACAAAACAAACTCTTCTAAAAGGGCAAGAAAGTATAAAA
AATCATTAAGTCCATGTGATTTGAACAGCTAGGTTATTTGTCCTTTGCTAGAATCAATATCTCTATGAAAGTCAAGAATATTAATCAATTAATCCTTCCAAAAATAGGACCAATGCTGTG
AAAAACCAAATGCCTCATTCACTGGTAACATGATGAGAGAACTAATAGACAATAAGACTGGCATTTGACTTGTATTGGTTTTCTAAATGTCTCATTCATTGGTAACTGGATGTGGTCAAT
GATTTTTATTTTCTCAAAACTGTACTCTTTTAGTTATTTTCTGTTAGGATAACAATATTATTATATGACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTAAATTTTAATTTATA
GAAGTCCTTTTTATAGGCGTCTATTTTCTTCTAAATAATCCTATAATGGAGTGCTCTAATTCCATATGCTACATTTTCATGACGCAGGCAGGGGGACCTTATTACCAAGTGAAGAAAGGG
AGATGGGATGGCAAAATATCAATGGCATCAAGGGTACCCTATAATCTACCTCAAGCAAATTCAACCATTGATCAACTACTGAAGCTTTTCAATTCCAAAGGATTAACACCACAAGATCTA
GTGGTTCTCTCAGGAGCACACACAATAGGTTTTGCTCATTGTAAGCATTTTATCAATCGCCTCTACAACTACGGTGGCACCAAGCAGCCTGACCCTGTGATTGACCCAAGGCTCCTCAAG
GCACTGAGAATGTCCTGCCCACAGTTTGGTGGAAATGAAGACATTGTTGCACCATTTGATGTTACAACTCCATTCTTGTTTGATCATGCTTATTATGGGAACTTGGAGGCTAAACTGGGC
TTGTTGGCCTCTGACCAAGCCCTGTTTCTGGACCCACGAACCAAGCCCTTGGTTCAGCAGCTTGGGACTAATAAGCAGAAATTCTTTCAGGCATTTTCACAAGCAATGGATAAAATGGGT
TCCATTGGTGTTAAAAGAGGAAGAAGACATGGTGAGAAGAGAAGAGATTGTAGTATACATGGGTTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCCCCTTCTTCTTCTTCTTCTGTTTGCCTTCTCCTCTCACTATCATTTGTTTTCGCTTGTTTGCTCATTTTCTTGCCAATTTCTCTAGCCAAAACCACCAACTCCACTCGCCTA
CCACGCCAACTTTCCATTAACTACTATGCAAAAAACTGTCCTCAACTTGAACAACTTGTTGGTTCAGTCACTTCCCAACAATTCAAAGAAACTCCAGTTTCAGGGCCAGCCACCATTCGC
CTATTCTTCCATGACTGCTTTGTAGAA
GGTTGTGATGCTTCTATCTTGATATCAACGAAGCCTGGAAGCAAAGAGTTGGCAGAGAAGGATGCAGAAGATAACAAGGATTTGAGGGTGGAG
GGATATGAGAGCATTAGAAAGGCTAAGGCATTGGTGGAGAGCAAGTGTCCTGGTGTTGTATCCTGTGCAGATATTCTTGCAATTGCTGCCAGAGATTATGTCCACCTG
GCAGGGGGACCT
TATTACCAAGTGAAGAAAGGGAGATGGGATGGCAAAATATCAATGGCATCAAGGGTACCCTATAATCTACCTCAAGCAAATTCAACCATTGATCAACTACTGAAGCTTTTCAATTCCAAA
GGATTAACACCACAAGATCTAGTGGTTCTCTCAGGAGCACACACAATAGGTTTTGCTCATTGTAAGCATTTTATCAATCGCCTCTACAACTACGGTGGCACCAAGCAGCCTGACCCTGTG
ATTGACCCAAGGCTCCTCAAGGCACTGAGAATGTCCTGCCCACAGTTTGGTGGAAATGAAGACATTGTTGCACCATTTGATGTTACAACTCCATTCTTGTTTGATCATGCTTATTATGGG
AACTTGGAGGCTAAACTGGGCTTGTTGGCCTCTGACCAAGCCCTGTTTCTGGACCCACGAACCAAGCCCTTGGTTCAGCAGCTTGGGACTAATAAGCAGAAATTCTTTCAGGCATTTTCA
CAAGCAATGGATAAAATGGGTTCCATTGGTGTTAAAAGAGGAAGAAGACATGGTGAGAAGAGAAGAGATTGTAGTATACATGGGTTA

Retrieve as FASTA