Entry information : MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Entry ID 381
Creation 2006-01-17 (Christophe Dunand)
Last sequence changes 2011-12-13
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Name (synonym) MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Pods
Roots
Seeds
Inducers Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Methyl jasmonate treatment
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx56
start..stop
S start..stop
GmPrx41 553 0 4..325 6..327
GmPrx236 549 0 23..325 27..329
LjPrx03 535 0 1..325 1..339
CsPrx04 514 0 9..325 11..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28604037..28604103 67 N° 2 28604795..28604943 149 N° 3 28605248..28605436 189 N° 4 28605916..28606081 166
N° 5 28606428..28606834 407  
join(28604037..28604103,28604795..28604943,28605248..28605436,28605916..28606081 ,28606428..28606834)


exon

Literature and cross-references MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Literature Hahn,M.G. et al., unpublished
DNA ref. Phytozome 11:   chr1 (28604037..28606834)
Cluster/Prediction ref. Phytozome Gene 11:   31093840 UniGene:   Mtr.6952
Omic ref. Gene atlas:   Mtr.8654.1.S1_at Legoo:   Mtr.8654.1.S1_at
Protein sequence: MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 325 (298)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
36225.41 (33200.8) Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-29o
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
8.01 (7.77) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 28 range:28-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYKSSSNSSFLFLLLLLHFNLGISQLQVNYYSKSCPKAEEIIKQQVNELYNKHGNTAISWVRNLFHDCIVSCDASLLLETVHGVVSEQTAERSFGMRNFKYVSTIKAALEKECPLTVSCADIVALSARDGIARLGGPNFEMKSGRKDSKESYVKVVEQFIPNHNDSISSVLSSFQAIGIDVEATVALLGAHSVGRVHCMNLVHRLYPTVDPTLDPTHAAYLKRRCPTPNPDPKAVQYVRNDLKTPMIIDNNYYKNILQHKGLLTVDEELATDPRTSPYVKKMAADNGYFNEQFSRAVQLLSENNPLIGDQGEIRKDCRYVNAN

Retrieve as FASTA  
Remarks Complete sequence from 28 ESTs and genomic sequence (Chromo 1, intron 5' and 3 introns)..
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAGTCTAGTTCTAATTCCTCTTTCCTCTTTCTATTGCTTCTCCTACATTTTAATTTGGGTACATTTCCTAACTCTTTTTCCTCAAATACTTTGTGGCCATTATTTAAGACA
TGTGACAATTTATACATATATAAGTATAGTATGCATTATCATGTGAAAAATATACATGCAACTTTCATGAGCTCCATGTTATTATTCTTCACTATCTTATATTTTTTTAATGGAAGGTAA
CTTGTTCTTATAAAATCAGTTTGTAAGGCTTGTTAGATTAGATGTATCTTCTTTTATACACTATTTTCAAGTGTTCTCTTTTCAATGTTTATTTTCAAAACACTCCCTCATGGCCTCACA
TCATATACTACAAGGTCAATGTTATCTAATTATATTTTTGGATTAGACCTAACTAATTAATTCTAACAAATTCTCATTTTGATATCATATTATGTTATTTTGAATTGAATATTATTTTTT
CATTAAAATGCAAGGGTGTCATAGAAGGATCCGTGTTTCCCACTTTGGAAAATTCTATACGTATTAATTTGTCTAAGTCACTTAATCTGATCTATTTAACTAATATTAGACAACTCAATT
TCTGATTTTGATATACAAATCAAGTCTACAATATAAAGTTTATGTGAATGCATAAAATCCTAATCTGTTATGGACACGTTATCTATTTCTTTAATTGTATTTTTGTAGATATTGTACCAT
TTCTTCTTTCATTATTAATGTCATGTATTTATGCATAGGGATAAGCCAACTACAGGTAAACTACTACTCCAAGAGCTGCCCAAAAGCAGAAGAGATCATCAAGCAACAAGTCAATGAATT
GTATAACAAGCATGGAAACACAGCAATTTCGTGGGTTAGAAATCTCTTCCATGATTGCATAGTCAAG
GTGAGTATAAATATATAGACACATAATTAATTACCAGCAGAGTTATATCATTT
CAGATTAAGAAGCAATCTATAAAACACATATATTATACTCCTCGGATTAGGAGTGTCCCTGTGTAGAATATGTATCGTATTCGAGAAACACCAACAAATATGATTATATTATTTCTTTTT
TTCAAATTATTATTGGTGTTGATGTATCCGTATCCGTGTTGTGTCCGGTGGTCCGTGTCTGAGACTGAGTCTCTGCTTCATAAGAAGCAAATTAATAATGATTTATATATGAGTTTTAAA
TGTCCTTGCAGTCATGTGATGCATCCCTGCTTTTGGAGACGGTGCACGGCGTGGTATCGGAGCAGACAGCGGAGAGAAGTTTTGGGATGAGAAACTTCAAGTATGTGAGCACCATCAAAG
CTGCTCTTGAAAAAGAATGTCCTTTGACAGTGTCATGCGCTGACATTGTTGCTCTTTCTGCTAGAGACGGTATTGCCAGG
GTATGTGTCTTTCTAATCATATATACATGTTGATAAGGAG
TGGAGCATTGACAAGTCTTACATAAAAAGTGAAACTAAACTCAAAAATATTATTTCACCTAATAGATCATTAATTTTTTTTTAAGTTCAACTCTCCCTCTAAATTTAGGGATATTTTTTT
CCACGCACATATACTTTGGAAAAATCTAGAAAAAATACAAGTTTTTTGCCATACCAATAGATAAATGTACTTTGTCACAAAGTGTACTTTTAAAGGGATACAGTTTTTAAGAAATCTTGG
AGGAAAAAGTACTTCTTTCAAATCTATTTGTCACTTTGTCTAAAACAAAAAAAATTGTTTCCCTAATTAATCACCAAAAGAAAAGGAAAAAGGTTAAAAATAAAGGGAAGTTATTATTTT
TAGAAAATCATTTTAGAAATTCTATGACTAATTTATATTTAGATGTTGATGTTGATGTTTGTCTGTTCTGTATATTAAGTTGGGAGGTCCAAACTTTGAAATGAAGAGTGGACGAAAGGA
TAGCAAAGAAAGCTATGTAAAGGTGGTGGAACAATTCATTCCAAATCATAATGACTCAATATCCTCAGTGCTTTCTAGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACGGTTGCTCT
TTTAG
GTACCAAATATTCTCTTTAATTGGCTAATTGCTTTCTGTTATTTCTGTTACACATCCACTGAAAACCGTTCCAATTACATTAACACACTTACTATTACTTTAAAATTTCAAAAGT
CAAACGTAAAACATAATTCATAAGCACCTTTCATTACATTAATAATACATGGACATCCACTTTTTATACACTTATCTGTGACAATGGTTAATCATGTTCGAAAATGTGGTTAAATTTAAC
TATATGCAATAACACAATTTTTAATGTAAAATAATTTTTTTGTAAGTGTGGGAGTCATGGAATATTTTTGTTTACAATTTAACATTACGTTGGTCACTTTGATTCAATTAGGAGCACACT
CGGTTGGAAGAGTACATTGCATGAATTTGGTCCACAGACTATACCCCACAGTGGATCCAACGTTAGATCCTACACATGCTGCCTACCTAAAACGTAGGTGCCCAACACCAAATCCAGATC
CAAAAGCTGTCCAATATGTGAGGAATGATCTAAAAACACCAATGATAATTGACAACAACTACTACAAAAACATCTTGCAACATAAGGGTCTTCTAACAGTGGATGAAGAACTAGCTACTG
ATCCAAGAACATCACCTTATGTGAAAAAAATGGCAGCTGATAATGGATACTTCAATGAACAATTCTCAAGGGCTGTTCAATTGTTATCAGAGAATAATCCTCTTATTGGAGATCAAGGTG
AAATTAGAAAGGATTGCCGTTACGTTAATGCCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAGTCTAGTTCTAATTCCTCTTTCCTCTTTCTATTGCTTCTCCTACATTTTAATTTGGGGATAAGCCAACTACAGGTAAACTACTACTCCAAGAGCTGCCCAAAAGCAGAA
GAGATCATCAAGCAACAAGTCAATGAATTGTATAACAAGCATGGAAACACAGCAATTTCGTGGGTTAGAAATCTCTTCCATGATTGCATAGTCAAG
TCATGTGATGCATCCCTGCTTTTG
GAGACGGTGCACGGCGTGGTATCGGAGCAGACAGCGGAGAGAAGTTTTGGGATGAGAAACTTCAAGTATGTGAGCACCATCAAAGCTGCTCTTGAAAAAGAATGTCCTTTGACAGTGTCA
TGCGCTGACATTGTTGCTCTTTCTGCTAGAGACGGTATTGCCAGG
TTGGGAGGTCCAAACTTTGAAATGAAGAGTGGACGAAAGGATAGCAAAGAAAGCTATGTAAAGGTGGTGGAACAA
TTCATTCCAAATCATAATGACTCAATATCCTCAGTGCTTTCTAGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACGGTTGCTCTTTTAG
GAGCACACTCGGTTGGAAGAGTACATTGC
ATGAATTTGGTCCACAGACTATACCCCACAGTGGATCCAACGTTAGATCCTACACATGCTGCCTACCTAAAACGTAGGTGCCCAACACCAAATCCAGATCCAAAAGCTGTCCAATATGTG
AGGAATGATCTAAAAACACCAATGATAATTGACAACAACTACTACAAAAACATCTTGCAACATAAGGGTCTTCTAACAGTGGATGAAGAACTAGCTACTGATCCAAGAACATCACCTTAT
GTGAAAAAAATGGCAGCTGATAATGGATACTTCAATGAACAATTCTCAAGGGCTGTTCAATTGTTATCAGAGAATAATCCTCTTATTGGAGATCAAGGTGAAATTAGAAAGGATTGCCGT
TACGTTAATGCCAATTAG

Retrieve as FASTA