Entry information : MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Entry ID 381
Creation 2006-01-17 (Christophe Dunand)
Last sequence changes 2011-12-13
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Name (synonym) MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Pods
Roots
Seeds
Inducers Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Methyl jasmonate treatment
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx56
start..stop
S start..stop
GmPrx41 553 0 4..325 6..327
GmPrx236 549 0 23..325 27..329
LjPrx03 535 0 1..325 1..339
CsPrx04 514 0 9..325 11..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28604037..28604103 67 N° 2 28604795..28604943 149 N° 3 28605248..28605436 189 N° 4 28605916..28606081 166
N° 5 28606428..28606834 407  
join(28604037..28604103,28604795..28604943,28605248..28605436,28605916..28606081 ,28606428..28606834)


exon

Literature and cross-references MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Literature Hahn,M.G. et al., unpublished
DNA ref. Phytozome 11:   chr1 (28604037..28606834)
Cluster/Prediction ref. Phytozome Gene 11:   31093840 UniGene:   Mtr.6952
Omic ref. Gene atlas:   Mtr.8654.1.S1_at Legoo:   Mtr.8654.1.S1_at
Protein sequence: MtPrx56 (Medtr1g066380.1[4.0]Medtr1g066380.1[3.5] / x)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (298)
PWM (Da):   %s   36225.41 (33200.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.01 (7.77) Peptide Signal:   %s   cut: 28 range:28-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYKSSSNSSFLFLLLLLHFNLGISQLQVNYYSKSCPKAEEIIKQQVNELYNKHGNTAISWVRNLFHDCIVSCDASLLLETVHGVVSEQTAERSFGMRNFKYVSTIKAALEKECPLTVSCADIVALSARDGIARLGGPNFEMKSGRKDSKESYVKVVEQFIPNHNDSISSVLSSFQAIGIDVEATVALLGAHSVGRVHCMNLVHRLYPTVDPTLDPTHAAYLKRRCPTPNPDPKAVQYVRNDLKTPMIIDNNYYKNILQHKGLLTVDEELATDPRTSPYVKKMAADNGYFNEQFSRAVQLLSENNPLIGDQGEIRKDCRYVNAN

Retrieve as FASTA  
Remarks Complete sequence from 28 ESTs and genomic sequence (Chromo 1, intron 5' and 3 introns)..
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAGTCTAGTTCTAATTCCTCTTTCCTCTTTCTATTGCTTCTCCTACATTTTAATTTGGGTACATTTCCTAACTCTTTTTCCTCAAATACTTTGTGGCCATTATTTAAGACA
TGTGACAATTTATACATATATAAGTATAGTATGCATTATCATGTGAAAAATATACATGCAACTTTCATGAGCTCCATGTTATTATTCTTCACTATCTTATATTTTTTTAATGGAAGGTAA
CTTGTTCTTATAAAATCAGTTTGTAAGGCTTGTTAGATTAGATGTATCTTCTTTTATACACTATTTTCAAGTGTTCTCTTTTCAATGTTTATTTTCAAAACACTCCCTCATGGCCTCACA
TCATATACTACAAGGTCAATGTTATCTAATTATATTTTTGGATTAGACCTAACTAATTAATTCTAACAAATTCTCATTTTGATATCATATTATGTTATTTTGAATTGAATATTATTTTTT
CATTAAAATGCAAGGGTGTCATAGAAGGATCCGTGTTTCCCACTTTGGAAAATTCTATACGTATTAATTTGTCTAAGTCACTTAATCTGATCTATTTAACTAATATTAGACAACTCAATT
TCTGATTTTGATATACAAATCAAGTCTACAATATAAAGTTTATGTGAATGCATAAAATCCTAATCTGTTATGGACACGTTATCTATTTCTTTAATTGTATTTTTGTAGATATTGTACCAT
TTCTTCTTTCATTATTAATGTCATGTATTTATGCATAGGGATAAGCCAACTACAGGTAAACTACTACTCCAAGAGCTGCCCAAAAGCAGAAGAGATCATCAAGCAACAAGTCAATGAATT
GTATAACAAGCATGGAAACACAGCAATTTCGTGGGTTAGAAATCTCTTCCATGATTGCATAGTCAAG
GTGAGTATAAATATATAGACACATAATTAATTACCAGCAGAGTTATATCATTT
CAGATTAAGAAGCAATCTATAAAACACATATATTATACTCCTCGGATTAGGAGTGTCCCTGTGTAGAATATGTATCGTATTCGAGAAACACCAACAAATATGATTATATTATTTCTTTTT
TTCAAATTATTATTGGTGTTGATGTATCCGTATCCGTGTTGTGTCCGGTGGTCCGTGTCTGAGACTGAGTCTCTGCTTCATAAGAAGCAAATTAATAATGATTTATATATGAGTTTTAAA
TGTCCTTGCAGTCATGTGATGCATCCCTGCTTTTGGAGACGGTGCACGGCGTGGTATCGGAGCAGACAGCGGAGAGAAGTTTTGGGATGAGAAACTTCAAGTATGTGAGCACCATCAAAG
CTGCTCTTGAAAAAGAATGTCCTTTGACAGTGTCATGCGCTGACATTGTTGCTCTTTCTGCTAGAGACGGTATTGCCAGG
GTATGTGTCTTTCTAATCATATATACATGTTGATAAGGAG
TGGAGCATTGACAAGTCTTACATAAAAAGTGAAACTAAACTCAAAAATATTATTTCACCTAATAGATCATTAATTTTTTTTTAAGTTCAACTCTCCCTCTAAATTTAGGGATATTTTTTT
CCACGCACATATACTTTGGAAAAATCTAGAAAAAATACAAGTTTTTTGCCATACCAATAGATAAATGTACTTTGTCACAAAGTGTACTTTTAAAGGGATACAGTTTTTAAGAAATCTTGG
AGGAAAAAGTACTTCTTTCAAATCTATTTGTCACTTTGTCTAAAACAAAAAAAATTGTTTCCCTAATTAATCACCAAAAGAAAAGGAAAAAGGTTAAAAATAAAGGGAAGTTATTATTTT
TAGAAAATCATTTTAGAAATTCTATGACTAATTTATATTTAGATGTTGATGTTGATGTTTGTCTGTTCTGTATATTAAGTTGGGAGGTCCAAACTTTGAAATGAAGAGTGGACGAAAGGA
TAGCAAAGAAAGCTATGTAAAGGTGGTGGAACAATTCATTCCAAATCATAATGACTCAATATCCTCAGTGCTTTCTAGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACGGTTGCTCT
TTTAG
GTACCAAATATTCTCTTTAATTGGCTAATTGCTTTCTGTTATTTCTGTTACACATCCACTGAAAACCGTTCCAATTACATTAACACACTTACTATTACTTTAAAATTTCAAAAGT
CAAACGTAAAACATAATTCATAAGCACCTTTCATTACATTAATAATACATGGACATCCACTTTTTATACACTTATCTGTGACAATGGTTAATCATGTTCGAAAATGTGGTTAAATTTAAC
TATATGCAATAACACAATTTTTAATGTAAAATAATTTTTTTGTAAGTGTGGGAGTCATGGAATATTTTTGTTTACAATTTAACATTACGTTGGTCACTTTGATTCAATTAGGAGCACACT
CGGTTGGAAGAGTACATTGCATGAATTTGGTCCACAGACTATACCCCACAGTGGATCCAACGTTAGATCCTACACATGCTGCCTACCTAAAACGTAGGTGCCCAACACCAAATCCAGATC
CAAAAGCTGTCCAATATGTGAGGAATGATCTAAAAACACCAATGATAATTGACAACAACTACTACAAAAACATCTTGCAACATAAGGGTCTTCTAACAGTGGATGAAGAACTAGCTACTG
ATCCAAGAACATCACCTTATGTGAAAAAAATGGCAGCTGATAATGGATACTTCAATGAACAATTCTCAAGGGCTGTTCAATTGTTATCAGAGAATAATCCTCTTATTGGAGATCAAGGTG
AAATTAGAAAGGATTGCCGTTACGTTAATGCCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAGTCTAGTTCTAATTCCTCTTTCCTCTTTCTATTGCTTCTCCTACATTTTAATTTGGGGATAAGCCAACTACAGGTAAACTACTACTCCAAGAGCTGCCCAAAAGCAGAA
GAGATCATCAAGCAACAAGTCAATGAATTGTATAACAAGCATGGAAACACAGCAATTTCGTGGGTTAGAAATCTCTTCCATGATTGCATAGTCAAG
TCATGTGATGCATCCCTGCTTTTG
GAGACGGTGCACGGCGTGGTATCGGAGCAGACAGCGGAGAGAAGTTTTGGGATGAGAAACTTCAAGTATGTGAGCACCATCAAAGCTGCTCTTGAAAAAGAATGTCCTTTGACAGTGTCA
TGCGCTGACATTGTTGCTCTTTCTGCTAGAGACGGTATTGCCAGG
TTGGGAGGTCCAAACTTTGAAATGAAGAGTGGACGAAAGGATAGCAAAGAAAGCTATGTAAAGGTGGTGGAACAA
TTCATTCCAAATCATAATGACTCAATATCCTCAGTGCTTTCTAGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACGGTTGCTCTTTTAG
GAGCACACTCGGTTGGAAGAGTACATTGC
ATGAATTTGGTCCACAGACTATACCCCACAGTGGATCCAACGTTAGATCCTACACATGCTGCCTACCTAAAACGTAGGTGCCCAACACCAAATCCAGATCCAAAAGCTGTCCAATATGTG
AGGAATGATCTAAAAACACCAATGATAATTGACAACAACTACTACAAAAACATCTTGCAACATAAGGGTCTTCTAACAGTGGATGAAGAACTAGCTACTGATCCAAGAACATCACCTTAT
GTGAAAAAAATGGCAGCTGATAATGGATACTTCAATGAACAATTCTCAAGGGCTGTTCAATTGTTATCAGAGAATAATCCTCTTATTGGAGATCAAGGTGAAATTAGAAAGGATTGCCGT
TACGTTAATGCCAATTAG

Retrieve as FASTA