Entry information : MtPrx57 (Medtr2g084080.1[4.0] / Medtr2g084080.1[3.5] / Medtr2g098020.1[3.0])
Entry ID 382
Creation 2007-03-27 (Christophe Dunand)
Last sequence changes 2007-03-27 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx57 (Medtr2g084080.1[4.0] / Medtr2g084080.1[3.5] / Medtr2g098020.1[3.0])
Name (synonym) MtPrx57 (Medtr2g084080.1[4.0] / Medtr2g084080.1[3.5] / Medtr2g098020.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Leaves
Inducers Colletotrichum inoculation
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx57
start..stop
S start..stop
MtPrx97 616 0 1..317 1..317
PsPrx11 562 0 1..317 1..318
MtPrx63 549 0 1..317 1..318
MtPrx28 549 0 1..317 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35308070..35308279 210 N° 2 35307780..35307971 192 N° 3 35307093..35307644 552  
complement(join(35307093..35307644,35307780..35307971,35308070..35308279))


exon

Literature and cross-references MtPrx57 (Medtr2g084080.1[4.0] / Medtr2g084080.1[3.5] / Medtr2g098020.1[3.0])
Literature Watson B.S. et al. Expressed Sequence Tags from the Samuel Roberts Noble Foundation. Medicago truncatula Phoma-infected library;
Unpublished (2002).
DNA ref. Phytozome 11:   chr2 (35308279..35307093)
Cluster/Prediction ref. Phytozome Gene 11:   31067263
Omic ref. Gene atlas:   Mtr.12006.1.S1_at   Mtr.12025.1.S1_at Legoo:   Mtr.12006.1.S1_at   Mtr.12025.1.S1_at
Protein sequence: MtPrx57 (Medtr2g084080.1[4.0] / Medtr2g084080.1[3.5] / Medtr2g098020.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   33965.05 (31462.7)  
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATFMKLFVILSIFSLLACSTNAQLVNNFYGTTCPSLQTIVRNKMTSAIKTEPRIGASILRLFFHDCFVNGCDGSILLDDTATFTGEKNAAPNKNSARGFEVIDTIKTSVEASCNATVSCADILALAARDGVFLLGGPTWVVPLGRRDARTASQSAANSQIPSPFSDLSTLTTMFSAKGLTASDLTVLSGAHTIGQGECQFFRNRIYNETNIDTNFATLRKSNCPLSGGDTNLAPLDTLTPTSFDNNYYKNLVASKGLFHSDQALFNNGSQDNLVRSYSTNGATFSRDFAVAMVKLSKISPLTGTNGEIRKNCRLVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2) and 4 ESTs (2 independant compiles: TC93000 (5', BQ141233 and BF519194) and TC84847 (3', BQ153052, BI269070). Cultivar="Jemalong A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTATGAAATTATTTGTTATACTCTCCATTTTTTCTCTCTTAGCTTGTTCTACAAATGCACAACTTGTTAATAACTTCTATGGTACAACCTGCCCTAGCCTTCAAACCATT
GTGCGCAATAAAATGACTAGTGCTATCAAAACAGAACCTCGGATCGGGGCTTCTATACTTCGCTTGTTCTTCCATGATTGCTTTGTTAAT
GTAAGATAATGTTCAAAAATAATTTATTTA
TGCATTATATATATATGGGCCATATTTTTAAAAAATTGCATAATCACGTTTCTATGTTTATTTTGTAGGGATGTGATGGATCAATCTTATTGGATGACACTGCCACCTTTACCGGTGAGA
AAAATGCCGCACCTAACAAAAATTCAGCTAGGGGTTTCGAAGTGATTGACACCATTAAAACCAGTGTTGAAGCTTCTTGCAATGCCACTGTATCTTGTGCTGATATTCTAGCACTTGCAG
CAAGAGATGGAGTATTTCTG
GTGAGTGGTCCATTACTCCATTCCAATTTCTTTCTTCTGATGCAAAACATATTAGAAAAAATTATACTCCATCTCGCTGAGAGAAACTTGAGTTACACTT
TCACCCATATTAATAGTTTTATTTTTTATTTGTAGCTTGGAGGACCAACATGGGTAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAAAGTGCAGCAAATAGTCAAATCCCTT
CACCATTTTCTGACCTTTCCACTCTCACTACAATGTTTTCAGCCAAGGGTCTAACTGCAAGTGACCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAGTGCCAATTTTTCA
GAAATCGCATATACAATGAAACCAACATTGACACAAACTTTGCAACCTTAAGGAAATCAAATTGTCCTCTTTCTGGTGGTGACACCAATTTAGCACCACTTGATACTCTCACTCCAACAA
GTTTTGATAACAATTACTATAAAAACCTTGTTGCAAGCAAAGGTCTTTTCCATTCTGATCAAGCTCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGTTATAGTACCAATGGTG
CTACTTTTTCTAGAGACTTTGCCGTTGCTATGGTGAAACTGAGTAAAATTAGTCCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGCAGGCTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTATGAAATTATTTGTTATACTCTCCATTTTTTCTCTCTTAGCTTGTTCTACAAATGCACAACTTGTTAATAACTTCTATGGTACAACCTGCCCTAGCCTTCAAACCATT
GTGCGCAATAAAATGACTAGTGCTATCAAAACAGAACCTCGGATCGGGGCTTCTATACTTCGCTTGTTCTTCCATGATTGCTTTGTTAAT
GGATGTGATGGATCAATCTTATTGGATGAC
ACTGCCACCTTTACCGGTGAGAAAAATGCCGCACCTAACAAAAATTCAGCTAGGGGTTTCGAAGTGATTGACACCATTAAAACCAGTGTTGAAGCTTCTTGCAATGCCACTGTATCTTGT
GCTGATATTCTAGCACTTGCAGCAAGAGATGGAGTATTTCTG
CTTGGAGGACCAACATGGGTAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAGCCAAAGTGCAGCAAATAGTCAA
ATCCCTTCACCATTTTCTGACCTTTCCACTCTCACTACAATGTTTTCAGCCAAGGGTCTAACTGCAAGTGACCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAGTGCCAA
TTTTTCAGAAATCGCATATACAATGAAACCAACATTGACACAAACTTTGCAACCTTAAGGAAATCAAATTGTCCTCTTTCTGGTGGTGACACCAATTTAGCACCACTTGATACTCTCACT
CCAACAAGTTTTGATAACAATTACTATAAAAACCTTGTTGCAAGCAAAGGTCTTTTCCATTCTGATCAAGCTCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGTTATAGTACC
AATGGTGCTACTTTTTCTAGAGACTTTGCCGTTGCTATGGTGAAACTGAGTAAAATTAGTCCTCTAACTGGGACTAATGGGGAGATTAGAAAGAATTGCAGGCTTGTGAATTGA

Retrieve as FASTA