Entry information : CnCcP01_grubiiH99
Entry ID 3838
Creation 2006-08-30 (Christophe Dunand)
Last sequence changes 2006-08-30 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-08-23 (Catherine Mathe (Scipio))
Peroxidase information: CnCcP01_grubiiH99
Name CnCcP01_grubiiH99
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Tremellomycetes Tremellaceae Filobasidiella
Organism Cryptococcus neoformans (Filobasidiella neoformans)    [TaxId: 5207 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CnCcP01_grubiiH99
start..stop
S start..stop
CnCcP01_JEC21 743 0 1..377 1..377
CgaCcP 681 0 1..377 1..377
CgaCcP01_R265 672 0 1..377 1..376
TmesCcP01 577 0 1..376 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1102017..1102136 120 N° 2 1102190..1102442 253 N° 3 1102506..1102645 140 N° 4 1102695..1102924 230
N° 5 1102978..1103039 62 N° 6 1103091..1103190 100 N° 7 1103247..1103300 54 N° 8 1103364..1103447 84
N° 9 1103502..1103592 91  
join(1102017..1102136,1102190..1102442,1102506..1102645,1102695..1102924,1102978 ..1103039,1103091..1103190,1103247..1103300,1103364..1103447,1103502..1103592)


exon

Literature and cross-references CnCcP01_grubiiH99
Literature Giles,S.S., Cox,G.M. and Perfect,J.R. Cloning and disruption of the Cryptococcus neoformans cytochrome c peroxidase and the effects on virulence. unpublished (06-AUG-2003)
Protein ref. UniProtKB:   Q6URB0
DNA ref. JGI genome:   cneoH99_Chr5 (1102017..1103592)
Protein sequence: CnCcP01_grubiiH99
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   41946.95  
PI (pH):   %s   9.3
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFRAPNLIRSTVGRRAGQTLNLRSQVIRRRFATEGGPEITKPSAPRSSNTGYIFAGLGVAAVGAAYYFYGTGRTEHDSTNKADTVVREAVATVEAKTGLRRGKDEYQKVYNRIAETLDKEGYDDGSLAPVLLRLAWHASGTYSKADGTGGSNFATMRFKPEAEHSANNGHVAREHMEKIKQEFPWISYGDLWTLGGVCAIQESGGPTIPWRPGRIDGYAAQVTPDGRLPDATQAQDHLRFIFNRMGFNDQEIVALSGAHAMGRCHNRSGFDGPWTFSPVTFSNQYFALLRDEPWQWKKWTGPAQFEDKKTKTLMMLPTDMALVKDKSFKKYVDIYADNEEKFFSDFAKAFSKLIELGVPERQWAGEPWTMATSD

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Strain="H99", variety="grubii".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTTAGAGCTCCCAATTTGATACGATCAACTGTTGGCCGAAGAGCCGGTCAAACTTTGAACCTGCGTTCTCAGGTTATTCGACGACGATTTGCAACTGAGGGTGGACCGGAGATT
GTAAGCAGCTTTATCAGCCTTGTTGACTGCAACATTTTACTGAACAGACGCAGACCAAACCATCTGCTCCACGATCGTCCAACACTGGCTATATCTTCGCAGGTCTCGGTGTTGCTGCCG
TCGGAGCTGCATATTACTTCTACGGCACCGGCAGGACCGAGCACGATTCTACCAATAAAGCTGATACGGTAGTGCGTGAAGCTGTTGCCACGGTCGAGGCCAAGACGGGTCTCAGAAGAG
GCAAGGACGAGTATCAAAAAGTCTATAATCGAATTGCAGAGACTCTCGACAAGGAGGGTTACGACG
GTTAGTTTTCAATCACTTGCTGAATGCGGTACCAGAGCACGGTGACTGATAAGG
AAATATCAGACGGTTCTTTGGCTCCCGTCCTTCTTCGCTTGGCTTGGCACGCCTCCGGCACCTATAGCAAAGCGGATGGAACTGGAGGATCGAACTTTGCTACCATGAGGTTCAAGCCCG
AGGCTGAGCACAGCGCGAACAATGGCCTA
GTGGGTGTTGATGCAAATGGACATATTTCTTGAGCTGACCATATCAAAGCATGTTGCCAGGGAGCATATGGAAAAGATCAAGCAGGAGTTC
CCCTGGATCTCTTATGGGGACCTATGGACCCTCGGTGGAGTCTGTGCCATCCAAGAGTCAGGCGGCCCTACCATCCCTTGGAGGCCTGGTAGAATTGACGGATACGCCGCTCAAGTCACT
CCCGATGGCAGGCTACCTGATGCCACTCAAGCCCAAGACCATTTGAGGTTTATCTTCAACCGCATGGG
GTAAGTCACCAGGTTTAGTAAAAAGATTAGGAAAACTTACAGCACTGTAATA
GCTTCAATGACCAAGAAATTGTTGCCCTTAGCGGAGCTCACGCCATGGGACGATGTCATCCTAGTAAGTTTTTTTTTTTCAATGATCAACATGAAATGTCTGACAGATCTTTAGACCGAT
CGGGCTTTGATGGCCCTTGGACTTTCTCCCCTGTAACCTTTTCCAACCAGTACTTTGCTCTTCTCCGCGACGAGCCTTGGCAATGGAAGAAGTG
GTGAGTACTCTATTATATCACCGGAA
ACGGTCAATGGCCTTATCCTAGTATTACAGGACCGGACCTGCCCAGTTCGAAGACAAGAAGACAAAGACCTTGATGATGCTTCCGTAAGCTGAGACCAGAGTCTCCCGACACGCCGAACT
GACCTTGATGTTGACCCATTTATACAGTACGGATATGGCGCTCGTTAAAGACAAGTCCTTCAAGAAGTACGTTGACATTTATGCCGATAACGAAGAGAAGTTCTTTAGCGAGTGAGTGCC
TGGTAATGATAAAGCGTTTGCTGGCAGTCGCTGACCCGACCATAGCTTCGCGAAAGCATTCTCCAAGCTCATTGAGCTTGGTGTCCCTGAGAGGCAATGGGCTGGGGAACCTTGGACTAT
GGCAACCAGCGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTTAGAGCTCCCAATTTGATACGATCAACTGTTGGCCGAAGAGCCGGTCAAACTTTGAACCTGCGTTCTCAGGTTATTCGACGACGATTTGCAACTGAGGGTGGACCGGAGATT
ACCAAACCATCTGCTCCACGATCGTCCAACACTGGCTATATCTTCGCAGGTCTCGGTGTTGCTGCCGTCGGAGCTGCATATTACTTCTACGGCACCGGCAGGACCGAGCACGATTCTACC
AATAAAGCTGATACGGTAGTGCGTGAAGCTGTTGCCACGGTCGAGGCCAAGACGGGTCTCAGAAGAGGCAAGGACGAGTATCAAAAAGTCTATAATCGAATTGCAGAGACTCTCGACAAG
GAGGGTTACGACG
ACGGTTCTTTGGCTCCCGTCCTTCTTCGCTTGGCTTGGCACGCCTCCGGCACCTATAGCAAAGCGGATGGAACTGGAGGATCGAACTTTGCTACCATGAGGTTCAAG
CCCGAGGCTGAGCACAGCGCGAACAATGGCCTA
CATGTTGCCAGGGAGCATATGGAAAAGATCAAGCAGGAGTTCCCCTGGATCTCTTATGGGGACCTATGGACCCTCGGTGGAGTCTGT
GCCATCCAAGAGTCAGGCGGCCCTACCATCCCTTGGAGGCCTGGTAGAATTGACGGATACGCCGCTCAAGTCACTCCCGATGGCAGGCTACCTGATGCCACTCAAGCCCAAGACCATTTG
AGGTTTATCTTCAACCGCATGGG
CTTCAATGACCAAGAAATTGTTGCCCTTAGCGGAGCTCACGCCATGGGACGATGTCATCCTAACCGATCGGGCTTTGATGGCCCTTGGACTTTCTCC
CCTGTAACCTTTTCCAACCAGTACTTTGCTCTTCTCCGCGACGAGCCTTGGCAATGGAAGAAGTG
GACCGGACCTGCCCAGTTCGAAGACAAGAAGACAAAGACCTTGATGATGCTTCCT
ACGGATATGGCGCTCGTTAAAGACAAGTCCTTCAAGAAGTACGTTGACATTTATGCCGATAACGAAGAGAAGTTCTTTAGCGA
CTTCGCGAAAGCATTCTCCAAGCTCATTGAGCTTGGT
GTCCCTGAGAGGCAATGGGCTGGGGAACCTTGGACTATGGCAACCAGCGATTAA

Retrieve as FASTA