Entry information : MtPrx60 (Medtr2g099175.1[4.0])
Entry ID 385
Creation 2008-12-07 (Christophe Dunand)
Last sequence changes 2008-12-07 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtPrx60 (Medtr2g099175.1[4.0])
Name (synonym) MtPrx60 (Medtr2g099175.1[4.0])
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Root tips
Roots
Inducers Fungus infection
Glomus versiforme infection
Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx60
start..stop
S start..stop
LjPrx22 541 0 5..336 5..334
GmPrx254 522 0 1..336 1..334
GmPrx28 512 0 1..336 1..334
PpePrx77 492 8e-177 4..336 9..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42538930..42539172 243 N° 2 42539572..42539754 183 N° 3 42539877..42540036 160 N° 4 42540116..42540540 425
join(42538930..42539172,42539572..42539754,42539877..42540036,42540116..42540540 )


exon

Literature and cross-references MtPrx60 (Medtr2g099175.1[4.0])
Literature Journet,E.P. et al., unpublished
DNA ref. Phytozome 11:   chr2 (42538930..42540540)
EST ref. GenBank:   BG586244 [5' end]   GE351515 [3' end]
Cluster/Prediction ref. Phytozome Gene 11:   31067891 UniGene:   Mtr.2062 [3' end]
Omic ref. Gene atlas:   Mtr.7245.1.S1_at   Mtr.9899.1.S1_at Legoo:   Mtr.7245.1.S1_at   Mtr.9899.1.S1_at
Protein sequence: MtPrx60 (Medtr2g099175.1[4.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (310)
PWM (Da):   %s   37352.83 (34608.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.6 (8.53) Peptide Signal:   %s   cut: 27 range:27-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRLMYVAFPLIIAFAVLSLCHGVAAAAATYPKPKLQWHYYHNTCRDAEVYVRHQVKIHWDQDKSITAKLLRLVYSDCFVNGCDASILLDEGPNPEKRAPQNRGLGGFVLIDRIKTVLESRCPGIVSCADILHLAARDAAKMAGAPGYPIFTGRKDGMKSDAASVDLPSPSISWQESLAYFKSKGLNVLDMTTLLGAHTLGQTHCSYIVDRLYNYNGTGNSDPSMDATFRDTLRGLCPPRTKKGQSDPLVYLNPDSGKNYIFRESYYKRILRNEAVLGIDQQLLFGDDTKEITEEFAAGFEDFRRSFAQSMFKMGNIKVLTGNQGEIRRSCRHTNK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). Cultivar="A17". Containing motif 'YSDC'. 7 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGACTTATGTATGTGGCTTTCCCACTAATAATCGCTTTTGCAGTGTTGAGCTTGTGCCATGGAGTGGCAGCAGCAGCAGCAACTTATCCAAAGCCAAAGTTGCAGTGGCATTAC
TATCACAACACATGCCGCGACGCAGAGGTGTATGTCCGGCACCAAGTGAAGATTCACTGGGATCAAGACAAAAGCATTACTGCCAAGTTACTACGCTTGGTTTACTCCGACTGTTTTGTC
AAT
GTATGTCCCAATTTTATTTTATTTTCTTTTATAATTTAGTACTAGCCAGTCTTTACTTTTCTCCATTTTTCAACTTTTTAAGCTAAGAAAGAGACATCCTGTGAGGTTAATGGCTGA
GAAGGAACTTTTAGGTAATAGGACTAGGAACGACTAAAGGACAGGTTACAAAAACAGCAGACCCTTGCTAAAATATATACAAGTTGCACTAAAAAATATATAGTCTAAACTCAAACACTC
TTGTTGTTCAATCTAAATTCAGCTGTTCCATTTAACTTGGTATTTAGAGTTCATGAGGTTTAAAGCATATGATTCCATTTAAACTTACCATTCTAAACATTATAAATGAACAAGTTTCAT
TTTTCTTTCTCCCGAAACTTAAATCGTTGTTTCGTGGCATAGGGTTGTGATGCATCAATACTGCTTGATGAAGGACCAAATCCAGAAAAAAGAGCACCACAAAACCGGGGGCTTGGAGGA
TTTGTACTAATTGACAGGATCAAAACTGTTCTGGAATCACGATGCCCTGGAATTGTCTCCTGTGCTGATATACTCCATCTCGCAGCTAGGGATGCTGCTAAAATG
GTATTCTTTCAACTA
GTCTACTTACAATTTCCTTCAGTATCCCCTCCGCAGAAAAATCTTCTCTCAAGGTAGGGGTAAAAGTTAAAAAAAACAGTAACCGATTTGAGAATTAATGTCAACAGGCAGGTGCACCGG
GTTATCCAATTTTCACAGGAAGAAAGGATGGCATGAAATCAGATGCTGCATCAGTAGACCTGCCATCACCATCCATTTCATGGCAGGAATCTCTAGCATACTTTAAATCAAAGGGACTGA
ACGTATTAGATATGACAACACTCTTAG
GTAAGGCAAGATTACACAATCAAGTAGAAATTACATGCTAACAATATGTTCTAAATGAGTCTGTTTCATACCAACACAGGAGCGCACACACTC
GGCCAAACACATTGTAGCTACATTGTTGACAGGCTGTATAATTACAATGGTACTGGAAACTCAGACCCAAGCATGGATGCTACTTTTCGAGACACATTGAGGGGACTTTGTCCCCCAAGA
ACAAAGAAAGGACAAAGTGACCCGCTGGTATACCTAAACCCAGACTCTGGAAAAAATTACATCTTCAGAGAATCATACTATAAAAGGATCCTGCGCAATGAAGCTGTCCTGGGAATCGAT
CAACAATTACTATTTGGTGATGACACTAAAGAGATCACCGAAGAATTTGCTGCTGGATTTGAAGATTTTAGGAGATCTTTTGCTCAATCCATGTTCAAAATGGGAAATATCAAAGTTTTA
ACAGGAAATCAAGGAGAGATACGCCGGAGTTGTCGACACACAAATAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGACTTATGTATGTGGCTTTCCCACTAATAATCGCTTTTGCAGTGTTGAGCTTGTGCCATGGAGTGGCAGCAGCAGCAGCAACTTATCCAAAGCCAAAGTTGCAGTGGCATTAC
TATCACAACACATGCCGCGACGCAGAGGTGTATGTCCGGCACCAAGTGAAGATTCACTGGGATCAAGACAAAAGCATTACTGCCAAGTTACTACGCTTGGTTTACTCCGACTGTTTTGTC
AAT
GGTTGTGATGCATCAATACTGCTTGATGAAGGACCAAATCCAGAAAAAAGAGCACCACAAAACCGGGGGCTTGGAGGATTTGTACTAATTGACAGGATCAAAACTGTTCTGGAATCA
CGATGCCCTGGAATTGTCTCCTGTGCTGATATACTCCATCTCGCAGCTAGGGATGCTGCTAAAATG
GCAGGTGCACCGGGTTATCCAATTTTCACAGGAAGAAAGGATGGCATGAAATCA
GATGCTGCATCAGTAGACCTGCCATCACCATCCATTTCATGGCAGGAATCTCTAGCATACTTTAAATCAAAGGGACTGAACGTATTAGATATGACAACACTCTTAG
GAGCGCACACACTC
GGCCAAACACATTGTAGCTACATTGTTGACAGGCTGTATAATTACAATGGTACTGGAAACTCAGACCCAAGCATGGATGCTACTTTTCGAGACACATTGAGGGGACTTTGTCCCCCAAGA
ACAAAGAAAGGACAAAGTGACCCGCTGGTATACCTAAACCCAGACTCTGGAAAAAATTACATCTTCAGAGAATCATACTATAAAAGGATCCTGCGCAATGAAGCTGTCCTGGGAATCGAT
CAACAATTACTATTTGGTGATGACACTAAAGAGATCACCGAAGAATTTGCTGCTGGATTTGAAGATTTTAGGAGATCTTTTGCTCAATCCATGTTCAAAATGGGAAATATCAAAGTTTTA
ACAGGAAATCAAGGAGAGATACGCCGGAGTTGTCGACACACAAATAAGTGA

Retrieve as FASTA