Entry information : MtPrx61 (Medtr7g026990.1[4.0]Medtr7g026990[3.5] / Medtr7g148470.1[3.0])
Entry ID 386
Creation 2008-10-08 (Christophe Dunand)
Last sequence changes 2008-10-08 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx61 (Medtr7g026990.1[4.0]Medtr7g026990[3.5] / Medtr7g148470.1[3.0])
Name (synonym) MtPrx61 (Medtr7g026990.1[4.0]Medtr7g026990[3.5] / Medtr7g148470.1[3.0])
Class Class III peroxidase     [Orthogroup: Prx198]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Nodules
Roots
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx61
start..stop
S start..stop
MtPrx39 406 3e-143 1..323 1..322
VvPrx35 395 7e-139 11..322 18..326
GrPrx38 394 9e-139 10..322 11..323
EgrPrx23 393 3e-138 25..322 22..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9156106..9156333 228 N° 2 9155487..9155678 192 N° 3 9155235..9155400 166 N° 4 9154758..9155143 386
complement(join(9154758..9155143,9155235..9155400,9155487..9155678,9156106..9156 333))


exon

Literature and cross-references MtPrx61 (Medtr7g026990.1[4.0]Medtr7g026990[3.5] / Medtr7g148470.1[3.0])
Literature Harrison,M.J. et al., unpublished.
DNA ref. Phytozome 12:   chr7 (9156333..9154758)
Cluster/Prediction ref. Phytozome Gene 12:   31080089
Omic ref. Gene atlas:   Mtr.28310.1.S1_at Legoo:   Mtr.28310.1.S1_at
Protein sequence: MtPrx61 (Medtr7g026990.1[4.0]Medtr7g026990[3.5] / Medtr7g148470.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (295)
PWM (Da):   %s   34975.4 (31941.7)  
PI (pH):   %s   4.93 (4.68) Peptide Signal:   %s   cut: 29 range:29-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSSKLMIKCWLLLNITFLIGISTSVGQLTNEMYYDNTCPNALVAIQQAVQNAVLGEARIGASLLRLHFQDCFVQGCDGSVLLDDTSSFKGEKNSLQNANSLRGFELIDDIKSTLETMCPNVVSCADILTVAARDAVVLLGGQSWNVPLGRRDSTTASLDASNSDIPAPSLNLDGLIATFARKNFTALEMVTLSGAHTIGDARCTSFRGRIYNETNIDPSFAESKRLLCPFNGGDNNISTLSNSSINFDNTYYNDLVSKKGLLHSDQQLLNGLSTSNQVIAYTTDNESFKRDFANVMLKMGMLSPLTGSDGQIRQNCRFINA

Retrieve as FASTA  
Remarks Comlpete sequence from genomic (chromo 7, 3 introns) and 2 ESTs. Cultivar="A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAGCTCCAAACTCATGATCAAGTGTTGGTTGCTACTGAATATTACATTTCTGATTGGGATAAGTACCTCAGTCGGTCAGCTAACCAATGAAATGTACTATGATAATACGTGT
CCCAATGCTCTTGTTGCAATTCAACAAGCAGTGCAAAATGCTGTGTTAGGAGAGGCTCGCATTGGAGCATCCTTGCTTCGACTCCATTTTCAGGACTGCTTTGTTCAA
GTAATTAATTAA
TTTCTTAATTTGCAGCATGCATATGATCATTATTATGTTTAGTTTCCCTACAATTTACTTCACGAAACTTTCAAGAGTGACGTGGATAACATATCGACCAATTAAAATATTTGGTTTTGC
ACAATACATAGAGGAGAGATAAATGTCAACGGGAGAGAGAAAGTGTAAATACACTCTCGGGATAAAGCATGTCGTGTCGTGATATATAGCATTTTTCTATATATATAAAAAATGTTTCAT
GCACACTCAACTTTTTCTACATTCATGAAATGTAAAATTGTACATGATTTAATTCAAATATATGATTACTATAGATCGCATTGAAAAATTGTGAAATTATGGTTAATCATAAGTTCAAAA
CCATATGTTTAAATGTGATTAACCATATAATGTGTTACTATTTATTTGCATGCAGGGATGTGATGGATCAGTATTGCTAGACGACACGTCAAGTTTCAAAGGTGAGAAGAATTCTTTACA
AAACGCAAACTCGCTAAGAGGTTTTGAGTTAATTGACGACATCAAATCTACATTGGAGACAATGTGTCCTAATGTTGTCTCTTGTGCTGACATCTTAACCGTTGCTGCTAGGGATGCTGT
TGTTCTT
GTAAGTATATATATATATCATTTCATCATTTATATAATTAAGATAAGATTAGTAATACGCATTAATTTATGTATGTATGTATATAGCTTGGCGGACAAAGCTGGAATGTACCA
TTAGGCAGAAGAGATTCAACAACAGCAAGCTTAGATGCATCAAATTCTGACATTCCAGCTCCCTCCTTGAACCTTGATGGCCTTATCGCCACTTTCGCCAGGAAAAATTTCACTGCCCTA
GAGATGGTTACTTTATCAG
GTAATTCAATAAACATTATTAATTAGTTAGGGTTCATGAATTCATGGGAGCAGTACGTAGTACTAATTAAGAAATGAAATTTTTGGTTCAGGTGCTCACAC
AATAGGGGATGCAAGGTGCACTTCATTCAGAGGAAGGATTTACAACGAAACAAACATAGACCCTTCATTTGCTGAATCAAAGAGGTTATTGTGTCCCTTCAATGGTGGTGATAACAATAT
ATCAACTTTATCCAATAGCTCAATTAATTTTGATAATACTTACTACAACGACTTGGTGAGTAAAAAGGGTTTGCTACACTCTGACCAACAACTGCTTAATGGATTATCCACTAGCAATCA
AGTCATAGCATATACCACAGACAATGAAAGTTTTAAAAGGGACTTTGCAAATGTAATGCTCAAGATGGGTATGCTTAGCCCACTTACTGGCTCTGATGGTCAGATCCGGCAAAACTGCAG
GTTCATCAATGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTAAGCTCCAAACTCATGATCAAGTGTTGGTTGCTACTGAATATTACATTTCTGATTGGGATAAGTACCTCAGTCGGTCAGCTAACCAATGAAATGTACTATGATAATACGTGT
CCCAATGCTCTTGTTGCAATTCAACAAGCAGTGCAAAATGCTGTGTTAGGAGAGGCTCGCATTGGAGCATCCTTGCTTCGACTCCATTTTCAGGACTGCTTTGTTCAA
GGATGTGATGGA
TCAGTATTGCTAGACGACACGTCAAGTTTCAAAGGTGAGAAGAATTCTTTACAAAACGCAAACTCGCTAAGAGGTTTTGAGTTAATTGACGACATCAAATCTACATTGGAGACAATGTGT
CCTAATGTTGTCTCTTGTGCTGACATCTTAACCGTTGCTGCTAGGGATGCTGTTGTTCTT
CTTGGCGGACAAAGCTGGAATGTACCATTAGGCAGAAGAGATTCAACAACAGCAAGCTTA
GATGCATCAAATTCTGACATTCCAGCTCCCTCCTTGAACCTTGATGGCCTTATCGCCACTTTCGCCAGGAAAAATTTCACTGCCCTAGAGATGGTTACTTTATCAG
GTGCTCACACAATA
GGGGATGCAAGGTGCACTTCATTCAGAGGAAGGATTTACAACGAAACAAACATAGACCCTTCATTTGCTGAATCAAAGAGGTTATTGTGTCCCTTCAATGGTGGTGATAACAATATATCA
ACTTTATCCAATAGCTCAATTAATTTTGATAATACTTACTACAACGACTTGGTGAGTAAAAAGGGTTTGCTACACTCTGACCAACAACTGCTTAATGGATTATCCACTAGCAATCAAGTC
ATAGCATATACCACAGACAATGAAAGTTTTAAAAGGGACTTTGCAAATGTAATGCTCAAGATGGGTATGCTTAGCCCACTTACTGGCTCTGATGGTCAGATCCGGCAAAACTGCAGGTTC
ATCAATGCTTAA

Retrieve as FASTA