Entry information : GauCIIBA01 (GauMnP01)
Entry ID 3874
Creation 2006-09-21 (Filippo Passardi)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: GauCIIBA01 (GauMnP01)
Name (synonym) GauCIIBA01 (GauMnP01)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Ganodermataceae Ganoderma
Organism Ganoderma australe    [TaxId: 34457 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GauCIIBA01
start..stop
S start..stop
GapCIIBA01 729 0 1..364 1..364
GfCIIBA01 641 0 1..364 1..364
GsppVP01 636 0 1..364 1..364
TvVP01 553 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..117 117 N° 2 173..216 44 N° 3 271..316 46 N° 4 377..435 59
N° 5 499..512 14 N° 6 566..686 121 N° 7 741..972 232 N° 8 1040..1209 170
N° 9 1286..1323 38 N° 10 1393..1605 213 N° 11 1667..1691 25 N° 12 1754..1769 16
join(1..117,173..216,271..316,377..435,499..512,566..686,741..972,1040..1209,128 6..1323,1393..1605,1667..1691,1754..1769)


exon

Literature and cross-references GauCIIBA01 (GauMnP01)
Literature Lay,C.-Y. and Hseu,R.-S. Manganese peroxidase of Ganoderma spp. Unpublished (27-OCT-2005)
Protein ref. UniProtKB:   Q2XQ50
DNA ref. GenBank:   DQ267753.1
Protein sequence: GauCIIBA01 (GauMnP01)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (346)
PWM (Da):   %s   38156.56 (36306.5)  
PI (pH):   %s   3.99 (3.95) Peptide Signal:   %s   cut: 19 range:19-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKVFLSLVVLASSVAAAVPSVGRRATCANGKTTANDACCVWFDVLDDIQENLFHGGQCGEDAHESLLTFHDAIAFSPALTAAGQFGGGGDGSIIAHSDVELTYPVNDGLDEIVEASRPFAIKHNVSFGDFIQFAGAVGVANCNGGPQLSFFAGRSNDSQPSPPNLVPLPSDTADTILSRFSDAGFDSVEVVWLLVPHTVGSQNTVDSIPGAPFDSTPSDFDAQFFVETMLNGTLVPGNGLQDGEVLSPYPGEFRLQSDFALSRDSRTTCEWQKMADRANMLEKFEITMLKMSLLGFDQSALTDCSDVIPTATGTVQDPFIPAGLTVDDLQPACSSSAFPTVTTVAGAVTSIPAVPLNS

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (11 introns). No EST available. More probably a versatile peroxidase (BLAST on PeroxiBase and presence of the motif evvWl).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCAAAAGTCTTCCTCTCCCTCGTCGTCCTCGCTTCGTCTGTCGCTGCCGCCGTGCCGTCGGTGGGCAGGCGTGCGACGTGTGCCAACGGGAAGACCACCGCCAACGATGCGGTA
CGTTCCATGCTTGTTGTCCCTGCATATCCTTGTCGCTGACGTTTGTGGACAGTGCTGTGTCTGGTTCGACGTCCTCGACGACATCCAAGAGAACCTGTAAGCATTGCCCTGCCTATATCC
GTGGATCATCGGCCTCATTCTCCATCACAGCTTCCATGGTGGACAGTGCGGGGAAGACGCTCATGAGTCCCTGAGGGTAAATATATCCCGATTGCCCCCAACTATTCGAGGACAGCTTGA
TAACTTTGATGTTTAGCTGACGTTCCACGACGCTATCGCGTTCTCTCCTGCTCTGACTGCAGCAGGCCAATTCGGGTGAGCCTTATTGCTTCCTTCCCGTTCGTTCATTTTCTGACAATT
TTCTGACCATACCAACAGTGGCGGTGGCGCTGGTAAGTCCTATGCTCTCCCACTCATCCTGTCTAGATGCTACATGTTGCCGCAGATGGCTCGATCATCGCCCACTCCGATGTCGAGTTG
ACGTATCCCGTCAACGACGGCCTGGATGAAATCGTCGAGGCTTCGCGTCCGTTTGCGATCAAGCACAACGTCTCCTTCGGTGACTT
GTAAGCATCTCCGAGCGGTGACGCGCCATGCCTT
ACTGATACCCTTGATGATAGCATTCAATTTGCCGGCGCCGTCGGGGTGGCGAACTGCAACGGTGGTCCCCAGCTCTCGTTCTTCGCCGGTCGCTCCAACGACTCGCAGCCGTCCCCTCCG
AACCTCGTCCCTCTCCCGTCGGACACTGCCGACACGATCCTGTCTCGCTTCAGCGATGCGGGCTTCGACTCTGTCGAGGTCGTGTGGCTCTTGGTCCCCCACACTGTCGGTTCGCAGAAC
ACCGTCGACCCG
GTCAGTGATCTCCATACCCCCATCCGAATGGTTGATGCTGACGTTTGTTTGTATCCTGTTACTGTAGAGCATTCCTGGTGCCCCGTTCGACTCGACGCCGTCGGACTT
TGACGCGCAGTTCTTCGTCGAGACGATGCTCAATGGCACGCTCGTCCCTGGTAACGGCCTCCAAGACGGAGAAGTGCTCTCGCCTTACCCTGGTGAATTCCGCCTTCAATCCGACTTCGC
CCTCTCTCG
GTGAGCCGTGTTCCCGCTCAACGTGATGCGCACAGCGCCATCGTTGCCGAGCTCATCACCACCCTGACATTGACAGCGACTCCCGCACCACCTGCGAGTGGCAAAAGATGA
TCG
GTACGTCACTCCCTTATCGGCATATCTTACCCCCGGCCTCAGTCTCACTCGCGTTCTGTCCGTCCACAGCGGACCGCGCGAACATGCTGGAGAAGTTCGAAATAACGATGCTCAAGA
TGTCGCTGCTCGGCTTCGACCAGTCCGCGCTCACCGACTGCTCCGACGTCATCCCCACCGCGACCGGCACGGTCCAGGACCCGTTCATCCCCGCGGGCCTGACGGTGGACGACCTCCAGC
CGGCGTGCTCGTCGTCTGCGTTCCCGACGGTGACCACTGTTGCTG
GTGCGTTTGTCCAGACTTCCTTCGTTCGGGGATGTCGGATTCTGACTAATTGGATGTGCAGGTGCCGTCACTTCT
ATCCCTGCTGT
GTAAGTTCCCTCCCATATGTTATAGTGATTGCTGCTTAGCCTTTATACTCATCGGTTTATAGGCCATTGAACTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCAAAAGTCTTCCTCTCCCTCGTCGTCCTCGCTTCGTCTGTCGCTGCCGCCGTGCCGTCGGTGGGCAGGCGTGCGACGTGTGCCAACGGGAAGACCACCGCCAACGATGCGTGC
TGTGTCTGGTTCGACGTCCTCGACGACATCCAAGAGAACCT
CTTCCATGGTGGACAGTGCGGGGAAGACGCTCATGAGTCCCTGAGGCTGACGTTCCACGACGCTATCGCGTTCTCTCCT
GCTCTGACTGCAGCAGGCCAATTCGG
TGGCGGTGGCGCTGATGGCTCGATCATCGCCCACTCCGATGTCGAGTTGACGTATCCCGTCAACGACGGCCTGGATGAAATCGTCGAGGCTTCG
CGTCCGTTTGCGATCAAGCACAACGTCTCCTTCGGTGACTT
CATTCAATTTGCCGGCGCCGTCGGGGTGGCGAACTGCAACGGTGGTCCCCAGCTCTCGTTCTTCGCCGGTCGCTCCAAC
GACTCGCAGCCGTCCCCTCCGAACCTCGTCCCTCTCCCGTCGGACACTGCCGACACGATCCTGTCTCGCTTCAGCGATGCGGGCTTCGACTCTGTCGAGGTCGTGTGGCTCTTGGTCCCC
CACACTGTCGGTTCGCAGAACACCGTCGACCCG
AGCATTCCTGGTGCCCCGTTCGACTCGACGCCGTCGGACTTTGACGCGCAGTTCTTCGTCGAGACGATGCTCAATGGCACGCTCGTC
CCTGGTAACGGCCTCCAAGACGGAGAAGTGCTCTCGCCTTACCCTGGTGAATTCCGCCTTCAATCCGACTTCGCCCTCTCTCG
CGACTCCCGCACCACCTGCGAGTGGCAAAAGATGATC
G
CGGACCGCGCGAACATGCTGGAGAAGTTCGAAATAACGATGCTCAAGATGTCGCTGCTCGGCTTCGACCAGTCCGCGCTCACCGACTGCTCCGACGTCATCCCCACCGCGACCGGCACG
GTCCAGGACCCGTTCATCCCCGCGGGCCTGACGGTGGACGACCTCCAGCCGGCGTGCTCGTCGTCTGCGTTCCCGACGGTGACCACTGTTGCTG
GTGCCGTCACTTCTATCCCTGCTGTG
CCATTGAACTCCTGA

Retrieve as FASTA