Entry information : MtPrx63 (Medtr2g084090.1[4.0]Medtr2g084090[3.5] / Medtr2g098010.1[3.0])
Entry ID 388
Creation 2007-03-27 (Christophe Dunand)
Last sequence changes 2007-03-27 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx63 (Medtr2g084090.1[4.0]Medtr2g084090[3.5] / Medtr2g098010.1[3.0])
Name (synonym) MtPrx63 (Medtr2g084090.1[4.0]Medtr2g084090[3.5] / Medtr2g098010.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Flowers
Pods
Seeds
Inducer Germination
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx63
start..stop
S start..stop
MtPrx57 549 0 1..318 1..317
MtPrx97 538 0 1..318 1..317
PsPrx11 512 0 1..318 1..318
MtPrx28 504 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35313389..35313598 210 N° 2 35312568..35312759 192 N° 3 35311436..35311990 555  
complement(join(35311436..35311990,35312568..35312759,35313389..35313598))


exon

Literature and cross-references MtPrx63 (Medtr2g084090.1[4.0]Medtr2g084090[3.5] / Medtr2g098010.1[3.0])
Literature REFERENCE 1; Torres-Jerez,I. et al., unpublished
REFERENCE 2; Town,C.D., Tallon,L.J., Jones,K., Hine,E., Arfsten,K., Wilhelm,K., Monaghan,E., Fadrosh,D.W., Koo,H., Cheung,F., Shetty,J., Viswanathan,L.D. and Ferriera,S. Medicago truncatula BAC genomic sequence.
DNA ref. Phytozome 11:   chr2 (35313598..35311436)
Cluster/Prediction ref. Phytozome Gene 11:   31062085
Omic ref. Gene atlas:   Mtr.45378.1.S1_at Legoo:   Mtr.45378.1.S1_at
Protein sequence: MtPrx63 (Medtr2g084090.1[4.0]Medtr2g084090[3.5] / Medtr2g098010.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (295)
PWM (Da):   %s   34574.31 (32016.0)  
PI (pH):   %s   7.88 (7.64) Peptide Signal:   %s   cut: 24 range:24-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATFTKLFFTLSIFHLLACSTNAQLIDNFYDQTCPCLQTIVRNTMTSAIKKEARIGASILRLFFHDCFVNGCDGSILLDDTDTFIGEKKAQPNNNSVKGFEVIDNIKNSVEASCNATVSCADILALAARDGVVLLGGPSWTVPLGRRDARTANQSAANSQIPRPSFNLTRLTTMFLAKGLTASDLTVLSGAHTIGQGECRLFRTRIYNETNIDTNFATLRKSNCSFSSDNDTNLAPLDTLTPTSFDNNYYKNLVASKGLFHSDQVLFNNGSQDNLVRSYSTNEAAFSTDFAAAMVKLSKISPLTGTNGEIRKNCRLVN*

Retrieve as FASTA  
Remarks Complete from genomic (chromo 2, introns 1 and 2) and 2 ESTs (BQ149522 and CX539201).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTACCAAATTATTTTTTACACTCTCGATTTTTCATCTCTTAGCTTGTTCTACCAATGCACAACTTATTGATAACTTCTATGACCAAACTTGTCCTTGCCTTCAAACCATT
GTGCGCAATACAATGACCAGTGCTATCAAAAAAGAAGCCCGTATTGGGGCTTCTATACTCCGCTTGTTCTTCCATGATTGTTTTGTAAAT
GTAAGATATTGTTAAAAAAATAATTTATTA
ATGCATTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAATTTCAGTTTATATCTTATTCTTACAATATAGGATATATTTATT
AGTAAAAGTCTTGAATAGTTCTATTACATTATATACATATCTATAGTCAACAGTTTTTATCCCTTTCAAAGTTGTCAAAATGTGTATAATTATACTCCCCAATATGTAGTACTCTATTTG
GTAAAATAGTTTTTGCGATTTGAGTCTTATAAAGAGAGATACTCTTCATCTTACAAATAGATTTTATAACAATGAATTATGCCAAATATATAAAAATCGAACACTTTTTTTAACTACAAA
AACCGAACATTTAGATTTCCACCCTCTACCCTCTAACACATGAAAAAACTATTTATTTTTTAGAATTAAAAAATATGGAAAACTATATTTCAAAACATGAAAAAACAAGCATGATAAAGT
TGCATTCTGAATTCCATAATCCGTTAAATAACATTATAAATATGAAACAAAATATATTGGCTCTATTTTTAAATAAAGATATAATCACATGTCTATTTATTTCTTTGTTTATTTTGTAGG
GATGCGATGGATCAATTTTATTGGATGATACTGACACCTTTATCGGTGAGAAAAAAGCCCAACCTAATAACAACTCAGTCAAGGGTTTCGAAGTGATTGATAACATTAAAAACAGTGTTG
AAGCTTCATGCAATGCCACTGTCTCTTGTGCCGATATTCTAGCACTTGCAGCAAGAGATGGAGTAGTTCTG
GTGAGTGATCCATTTCTTTCTTTCTTAATTTCGTTTTTGTTAGAACAAT
AATTTGATTTGGAAAAGAAGATAATATAACTGGCAACGATTTGGCCAAAAATTAGTTCATTTTTTAATAGGAAAATGTTTATTATGTGTGTTATGTTCCATGTATGTAAGTACCATTCAA
ATGTGTGTAAGTACTATTCATATTTATGTGTATGATTTTTATTTAATTAATTAATGCCGGTATAAGAGAGACATCACTTCTCATATATTTAGGTAAAGGAAGAATTATGTCAATCACTCT
ATCAAGGAAATAACAAACAAGTACCAATATATATAAAATAGGGAAATATTTACGAGTAGGACATTTCTTAAGGACCATAAATAGTAAATATTTATAAAAATGTATGTAATGAATACATTG
TAAATTAAAATATTTAATTTTTTTAAAGAAAATTTGTTTATTTTAGAATGCTTAAAAAATATCTCGGGAGCATTTGTCAAATAAAACACTGTCTTACGATGTTTTCTACTTTTAGTTTTG
GTTCATCATCACTGTCTGGACACAATGTTTCAATTAATTAATTTGTAGCTTGGAGGACCCTCATGGACAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAATCAAAGTGCAGCAAAT
AGCCAAATCCCTAGACCATCCTTTAACCTAACCAGACTCACTACAATGTTTTTAGCCAAGGGTCTAACTGCAAGTGATCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAG
TGTCGATTGTTCAGAACTCGCATATACAATGAAACCAACATTGACACAAACTTCGCAACCTTAAGAAAATCCAACTGTTCTTTTTCTAGTGACAATGACACCAATTTAGCACCACTTGAT
ACTCTCACTCCAACAAGTTTTGACAACAATTATTATAAAAACCTTGTTGCAAGCAAAGGTCTATTCCATTCTGATCAAGTCCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGT
TATAGTACCAATGAGGCTGCTTTTTCTACAGACTTTGCTGCTGCTATGGTGAAACTGAGTAAAATCAGTCCTCTCACTGGGACTAATGGGGAGATCAGAAAGAATTGTAGGCTTGTGAAT
TGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCTTTACCAAATTATTTTTTACACTCTCGATTTTTCATCTCTTAGCTTGTTCTACCAATGCACAACTTATTGATAACTTCTATGACCAAACTTGTCCTTGCCTTCAAACCATT
GTGCGCAATACAATGACCAGTGCTATCAAAAAAGAAGCCCGTATTGGGGCTTCTATACTCCGCTTGTTCTTCCATGATTGTTTTGTAAAT
GGATGCGATGGATCAATTTTATTGGATGAT
ACTGACACCTTTATCGGTGAGAAAAAAGCCCAACCTAATAACAACTCAGTCAAGGGTTTCGAAGTGATTGATAACATTAAAAACAGTGTTGAAGCTTCATGCAATGCCACTGTCTCTTGT
GCCGATATTCTAGCACTTGCAGCAAGAGATGGAGTAGTTCTG
CTTGGAGGACCCTCATGGACAGTACCACTTGGAAGAAGAGATGCAAGAACAGCAAATCAAAGTGCAGCAAATAGCCAA
ATCCCTAGACCATCCTTTAACCTAACCAGACTCACTACAATGTTTTTAGCCAAGGGTCTAACTGCAAGTGATCTCACAGTACTTTCTGGTGCACACACCATAGGCCAAGGAGAGTGTCGA
TTGTTCAGAACTCGCATATACAATGAAACCAACATTGACACAAACTTCGCAACCTTAAGAAAATCCAACTGTTCTTTTTCTAGTGACAATGACACCAATTTAGCACCACTTGATACTCTC
ACTCCAACAAGTTTTGACAACAATTATTATAAAAACCTTGTTGCAAGCAAAGGTCTATTCCATTCTGATCAAGTCCTTTTCAATAATGGGTCTCAAGATAATTTGGTTAGGAGTTATAGT
ACCAATGAGGCTGCTTTTTCTACAGACTTTGCTGCTGCTATGGTGAAACTGAGTAAAATCAGTCCTCTCACTGGGACTAATGGGGAGATCAGAAAGAATTGTAGGCTTGTGAATTGA

Retrieve as FASTA