Entry information : GfCIIBA01 (GfMnP01 / mnp0109)
Entry ID 3882
Creation 2006-09-21 (Filippo Passardi)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: GfCIIBA01 (GfMnP01 / mnp0109)
Name (synonym) GfCIIBA01 (GfMnP01 / mnp0109)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Ganodermataceae Ganoderma
Organism Ganoderma formosanum    [TaxId: 34459 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor Pathogen interaction
Best BLASTp hits
Perox score E-value GfCIIBA01
start..stop
S start..stop
GauCIIBA01 672 0 1..364 1..364
GapCIIBA01 670 0 1..364 1..364
GsppVP01 633 0 1..364 1..364
TvVP01 565 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..117 117 N° 2 172..215 44 N° 3 270..315 46 N° 4 376..434 59
N° 5 486..499 14 N° 6 555..675 121 N° 7 750..981 232 N° 8 1073..1242 170
N° 9 1331..1368 38 N° 10 1455..1667 213 N° 11 1740..1764 25 N° 12 1831..1846 16
join(1..117,172..215,270..315,376..434,486..499,555..675,750..981,1073..1242,133 1..1368,1455..1667,1740..1764,1831..1846)


exon

Literature and cross-references GfCIIBA01 (GfMnP01 / mnp0109)
Literature Lay,C.-Y. and Hseu,R.-S. Direct Submission. Submitted (27-OCT-2005)
Protein ref. UniProtKB:   Q2XQ51
DNA ref. GenBank:   DQ267752
Protein sequence: GfCIIBA01 (GfMnP01 / mnp0109)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (346)
PWM (Da):   %s   38133.39 (36327.4)  
PI (pH):   %s   4.06 (4.01) Peptide Signal:   %s   cut: 19 range:19-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKVFLSLVVLAASAAAAVPSVSRRATCSNGKTTANDACCVWFDVLDDIQENLFHGGQCGEDAHESLLTFHDAIGFSPALTAAGQFGGGGDGSIIAHSDVEMTYPANDGLDEIIEASRPFAIKHNVSFGDFIQFAGAVGVANCNGGPQLSFFAGRSNDSQPSPPNLVPLPSDSADSILSRFSDAGFASVEVVWLLVSHTVGSQNTVDSIPGAPFDSTPSDFDAQFFVETMLNGTLVPGDALHDGEVNSPYPGEFRLQSDFALSRDSRTACEWQKMADRANMLEKFEVTMLKMSLLGFNQSMLTDCSDVIPTATGTVQDPFIPAGLTVDDLQPACSSTAFPTVNTVAGAVTSIPAVPLNS

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (11 introns). No EST available. More probably a versatile peroxidase (BLAST on PeroxiBase and presence of the motif evvWl).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCAAAAGTCTTCCTCTCCCTCGTCGTCCTCGCTGCGTCCGCGGCCGCGGCGGTGCCGTCGGTCAGCAGGCGTGCGACGTGCAGCAACGGAAAGACCACTGCCAATGACGCGGTA
GGCTCCATTCCTGCCCTCCGTGCAATCGTCCTTGCTGACGATTACCGACAGTGCTGTGTCTGGTTCGACGTGCTCGACGACATCCAAGAGAACCTGTAAGCATTGCGCCGACTGCTTCCG
TCGATCGTCGGTCTCATTGCCCCTTACAGCTTCCATGGTGGACAGTGCGGGGAAGACGCTCATGAGTCCCTGAGGGTAAATATACCCTGATTGCCCCCAGCTCTCCAAGGACAGCTTGTC
AACTTTGGTTTTCAGTTGACTTTCCACGACGCTATCGGTTTCTCCCCGGCTCTGACTGCTGCAGGTCAATTCGGGTGAGTCTCGTTACTTTCTCCCTTTTCACCCATTTCTGACGTCTCG
AATAGTGGCGGCGGCGCTGGTAAGTCCATTAGGGTTTTCCACTCATCATATCTAGACGCTACACGTTGCTGCAGATGGCTCGATCATCGCCCACTCCGACGTCGAGATGACATACCCCGC
GAACGACGGCCTGGACGAGATCATCGAGGCATCGCGCCCGTTCGCGATCAAGCACAACGTCTCCTTCGGTGACTT
GTAAGCTTCTCTTCTCCGCCCCGGGACGCCCCAACCCAACAACCG
CATATTGAATCTGATATTCGTGATGGCAGCATCCAATTCGCGGGCGCCGTCGGGGTCGCGAACTGCAACGGCGGCCCCCAGCTCTCGTTCTTCGCGGGGCGCTCAAACGATTCCCAGCCG
TCTCCTCCGAACCTCGTCCCTCTCCCGTCGGACAGTGCCGACTCAATTCTCTCTCGCTTCAGCGACGCGGGCTTCGCTTCCGTCGAAGTCGTCTGGCTCCTCGTCTCCCACACCGTCGGC
TCGCAGAACACCGTCGACCCT
GTCAGTACTCTCACATCGCGATCCAGCCCCATCCTTCCCCAAAAATGATTGAGCGGTCGAGGCTGACGCACTGTCTACTGTTTCCCATCAGAGCATCCC
TGGGGCGCCCTTCGACTCGACGCCGTCGGACTTCGATGCGCAATTCTTCGTCGAGACGATGCTCAACGGCACGCTCGTCCCCGGCGACGCGCTCCACGATGGTGAGGTGAACTCTCCCTA
CCCTGGCGAGTTCCGTCTCCAGTCCGACTTCGCGCTCTCTCG
GTTAGTGGTGCTCCCTCGTAACGCAACATGACGCCCCAGGCGCCACCATCACTGTATTATTGAGCTCATCACCTCTTG
ATATCGACAGCGACTCCCGTACCGCCTGCGAGTGGCAAAAGATGATCGGTACGTCCAGCCCACCCTCTATTAGTCCTTGCCCTCCCCGATGTCCCAGCCCGTGGCCTACGTAATCGTGCT
CTATCCATCCACAGCCGACCGCGCGAACATGCTGGAGAAGTTCGAAGTGACGATGCTCAAGATGTCGCTGCTCGGCTTCAACCAGTCCATGCTCACTGACTGCTCTGACGTCATCCCCAC
CGCGACCGGCACGGTCCAGGACCCGTTCATCCCCGCGGGTCTGACGGTGGACGACCTCCAGCCGGCGTGCTCGTCGACCGCGTTCCCCACGGTGAACACTGTTGCTG
GTGCGTCACAGCG
TTCATCGGAGCCGTCATTCGGGGATCTCGCGTTCTGACAGACTTTTTTCCGATGTATAGGTGCCGTCACTTCCATCCCTGCCGTGTAAGTGACTTCCTACGTGTTGCCTATAGATTGATG
CTTAAACTCTAAATTTGGCGTTTGCTATAGGCCCTTGAACTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCAAAAGTCTTCCTCTCCCTCGTCGTCCTCGCTGCGTCCGCGGCCGCGGCGGTGCCGTCGGTCAGCAGGCGTGCGACGTGCAGCAACGGAAAGACCACTGCCAATGACGCGTGC
TGTGTCTGGTTCGACGTGCTCGACGACATCCAAGAGAACCT
CTTCCATGGTGGACAGTGCGGGGAAGACGCTCATGAGTCCCTGAGGTTGACTTTCCACGACGCTATCGGTTTCTCCCCG
GCTCTGACTGCTGCAGGTCAATTCGG
TGGCGGCGGCGCTGATGGCTCGATCATCGCCCACTCCGACGTCGAGATGACATACCCCGCGAACGACGGCCTGGACGAGATCATCGAGGCATCG
CGCCCGTTCGCGATCAAGCACAACGTCTCCTTCGGTGACTT
CATCCAATTCGCGGGCGCCGTCGGGGTCGCGAACTGCAACGGCGGCCCCCAGCTCTCGTTCTTCGCGGGGCGCTCAAAC
GATTCCCAGCCGTCTCCTCCGAACCTCGTCCCTCTCCCGTCGGACAGTGCCGACTCAATTCTCTCTCGCTTCAGCGACGCGGGCTTCGCTTCCGTCGAAGTCGTCTGGCTCCTCGTCTCC
CACACCGTCGGCTCGCAGAACACCGTCGACCCT
AGCATCCCTGGGGCGCCCTTCGACTCGACGCCGTCGGACTTCGATGCGCAATTCTTCGTCGAGACGATGCTCAACGGCACGCTCGTC
CCCGGCGACGCGCTCCACGATGGTGAGGTGAACTCTCCCTACCCTGGCGAGTTCCGTCTCCAGTCCGACTTCGCGCTCTCTCG
CGACTCCCGTACCGCCTGCGAGTGGCAAAAGATGATC
G
CCGACCGCGCGAACATGCTGGAGAAGTTCGAAGTGACGATGCTCAAGATGTCGCTGCTCGGCTTCAACCAGTCCATGCTCACTGACTGCTCTGACGTCATCCCCACCGCGACCGGCACG
GTCCAGGACCCGTTCATCCCCGCGGGTCTGACGGTGGACGACCTCCAGCCGGCGTGCTCGTCGACCGCGTTCCCCACGGTGAACACTGTTGCTG
GTGCCGTCACTTCCATCCCTGCCGTG
CCCTTGAACTCCTGA

Retrieve as FASTA