Entry information : LedCIIBB01 (mnp1)
Entry ID 3886
Creation 2006-09-22 (Filippo Passardi)
Last sequence changes 2011-11-18 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-08-22 (Nizar Fawal)
Peroxidase information: LedCIIBB01 (mnp1)
Name (synonym) LedCIIBB01 (mnp1)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Marasmiaceae Lentinula
Organism Lentinula edodes (Shiitake mushroom)    [TaxId: 5353 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LedCIIBB01
start..stop
S start..stop
GluxCIIBB 621 0 1..364 1..364
PcriCIIBB05 486 8e-174 1..364 1..358
PcriCIIBB07 485 3e-173 26..364 24..359
PoVP06_PC9 474 4e-169 9..350 7..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1285..1345 61 N° 2 1404..1540 137 N° 3 1596..1654 59 N° 4 1708..1772 65
N° 5 1822..1897 76 N° 6 1953..1975 23 N° 7 2031..2129 99 N° 8 2181..2256 76
N° 9 2313..2349 37 N° 10 2412..2500 89 N° 11 2554..2623 70 N° 12 2684..2693 10
N° 13 2750..2785 36 N° 14 2840..3018 179 N° 15 3078..3117 40 N° 16 3178..3202 25
N° 17 3257..3269 13  
join(1285..1345,1404..1540,1596..1654,1708..1772,1822..1897,1953..1975,2031..212 9,2181..2256,2313..2349,2412..2500,2554..2623,2684..2693,2750..2785,2840..3018,3 078..3117,3178..3202,3257..3269)


exon

Literature and cross-references LedCIIBB01 (mnp1)
Literature Nagai,M., Sakamoto,Y., Nakade,K. and Sato,T. Isolation and characterization of a gene encoding a manganese peroxidase from Lentinula edodes. Unpublished (08-NOV-2005)
Protein ref. UniProtKB:   Q2L556
DNA ref. GenBank:   AB241061
Protein sequence: LedCIIBB01 (mnp1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   37791.55 (35688.4)  
PI (pH):   %s   4.13 (4.13) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFFIGLLSTALTLATLPGANAVPHNNKRFACADGVHTTSNEVCCQLFPLVDQLQSDLFDGGECGEAHESLRLTFHDAIGFSPTKGGGGADGSIIAFSDIETAFHAGGIDDIVDAQKSFMASHNVTINPGDFIQLAGAGVSNCPGAPQLEFLFGRPPPVAASPDLLIPEPFDTVDSILARFSEAGFNASEVVALLGSHTVAAADTIDTIPGTPFDSTPGLFDTQVFIEVQMRGILFPGTGGNQGEVESPVPGEIRLQSDSLARDSRTACDWQSFANNQAGFQNAFRAAMQKMAIIGHDRDALVDCSDVIPVPKPLPASAGPHLLPDTTHGDIEQCATAPFPVLTALPGPATSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (16 introns). Agricola="IND43899593". no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTTTTATCGGACTTCTCAGTACTGCCCTTACTCTCGCGACTCTTCCAGGCGCGAACGGTAAGATGAGACCTTGTCTACATTGTTCTTGTATAAAAACAACCGTTGGCGTTTACAGC
TGTTCCTCACAACAATAAGCGTTTTGCATGCGCTGATGGAGTGCACACTACGTCCAATGAAGTGTGCTGTCAATTGTTCCCTCTCGTTGATCAGTTACAGTCGGATTTGTTTGACGGAGG
GGAATGTGGTGAAGAG
GTTCAACCTCCTCCTCTATTTCGGTATTTTCTTGCTAACGGCTAACTCTGTCCAGGCTCATGAATCTCTGCGTTTGACTTTTCATGATGCCATTGGGTTTTCTC
CGACCAAAGG
GTGGATTACTTTTCTTCATTTTATGTGTACCCATTATTCAAGTTTTGTCTCAGGGGAGGCGGCGCGGACGGTTCCATTATAGCGTTTTCTGACATCGAAACTGCATTTCA
TGCCAATG
GTCTGCTCATGTCCTTAGTAAAAAACCCACCTGCCTTAAATATCAACAGGTGGTATCGATGATATTGTGGATGCTCAAAAGTCGTTTATGGCTTCTCACAATGTCACCATAA
ACCCCGGAGACTT
GTACGATGCATTGCGTCTTTTGTGTTCCAGTTTTCTCATTGATCTTGATCTCTAGTATTCAACTTGCAGGTGCAGTAGGTGAGTTATTCCATTGCTCTAAATCTTCC
TGATCTTCTCAATTTCTGCAATACAGGAGTAAGCAATTGTCCTGGTGCTCCCCAACTCGAGTTTCTTTTTGGACGACCTCCTCCTGTGGCTGCGTCCCCTGACCTCTTGATTCCTGAGCC
TTTCG
GTAATATTATTTATACTCTTTTGGCGCTTTGACGTTGATTAATTCTTCTAGACACTGTCGATTCGATCCTTGCCAGGTTTTCTGAGGCTGGTTTCAATGCTTCTGAAGTGGTTGC
TCTTTTGGGATC
GTTCGTCTCATTTGTTAGAGTCATGAGTCCAGGATTTCATTCTCACTTCTGAATAGTCATACTGTCGCTGCAGCTGACACCATTGATACCACAGTAAGTCAGGGTGTT
ATGCATGAAAAGTTTTGTCTTCGGTGAACTGACCCGCCCTGATATAGATTCCTGGAACTCCTTTCGACTCGACTCCTGGTTTATTTGATACCCAGGTGTTTATTGAGGTGCAGATGAGAG
GTATTCTGTTCCCCGG
GTAAGTGCACATGTTCGACCAAGTTGCAAAGCATATATTAATTGTGGCTACAGAACCGGAGGTAATCAAGGCGAAGTTGAATCTCCAGTGCCGGGAGAAATACG
TTTACAATCAGACTCCGAG
GTGAATATTCAATGAATTTCGATTCGGAGCCTTTCTTACCCAGTGCTTTTACCATTATAGCTGGCTAGAGGTGCGCTTCAATTCGACCTTGTACCGCCTTG
ATTATTCATTCTGTGAAAAACAAAGATTCCCGCACTGCTTGCGATTGGCAGTCTTTCGCTAGTACGTATAAGGATTCAGTCGAAGGAGGCCAAAATCAGATTTTTTGTATTTCAGATAAC
CAGGCTGGCTTCCAAAACGCGTTTAGAGCTGCAATGCAAAAGATGGCGATCATTGGCCATGATAGAGACGCCCTCGTCGACTGTTCGGACGTTATTCCCGTCCCGAAACCACTTCCGGCC
AGTGCTGGACCTCACCTGCTACCTGACACTACTCACGGCGATATTGAACAGGCT
GTACGGTGTTCAGATAGCTTATACATATCTATAAAACTGACATCCTTTATCGACGACAGTGCGCTA
CTGCTCCGTTCCCTGTTCTTACTGCTCTTCCGG
GTGAGTGGAAAGTTCTGTTGCAGAATTGACTGTTATGTACTCATTACAATGCTTTCACAGGACCCGCTACATCTGTTGCTCCAGTGT
ATGTTGATTCTTTGGACATGATAGTCAATGTATCCTAAGTCCTCCCTTTCAGCCCACCATCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTTTTATCGGACTTCTCAGTACTGCCCTTACTCTCGCGACTCTTCCAGGCGCGAACGCTGTTCCTCACAACAATAAGCGTTTTGCATGCGCTGATGGAGTGCACACTACGTCCAAT
GAAGTGTGCTGTCAATTGTTCCCTCTCGTTGATCAGTTACAGTCGGATTTGTTTGACGGAGGGGAATGTGGTGAAGAG
GCTCATGAATCTCTGCGTTTGACTTTTCATGATGCCATTGGG
TTTTCTCCGACCAAAGG
GGGAGGCGGCGCGGACGGTTCCATTATAGCGTTTTCTGACATCGAAACTGCATTTCATGCCAATGGTGGTATCGATGATATTGTGGATGCTCAAAAGTCGTTT
ATGGCTTCTCACAATGTCACCATAAACCCCGGAGACTT
TATTCAACTTGCAGGTGCAGTAGGAGTAAGCAATTGTCCTGGTGCTCCCCAACTCGAGTTTCTTTTTGGACGACCTCCTCCT
GTGGCTGCGTCCCCTGACCTCTTGATTCCTGAGCCTTTCG
ACACTGTCGATTCGATCCTTGCCAGGTTTTCTGAGGCTGGTTTCAATGCTTCTGAAGTGGTTGCTCTTTTGGGATCTCAT
ACTGTCGCTGCAGCTGACACCATTGATACCACA
ATTCCTGGAACTCCTTTCGACTCGACTCCTGGTTTATTTGATACCCAGGTGTTTATTGAGGTGCAGATGAGAGGTATTCTGTTCCCC
GG
AACCGGAGGTAATCAAGGCGAAGTTGAATCTCCAGTGCCGGGAGAAATACGTTTACAATCAGACTCCGAGCTGGCTAGAGATTCCCGCACTGCTTGCGATTGGCAGTCTTTCGCTAAT
AACCAGGCTGGCTTCCAAAACGCGTTTAGAGCTGCAATGCAAAAGATGGCGATCATTGGCCATGATAGAGACGCCCTCGTCGACTGTTCGGACGTTATTCCCGTCCCGAAACCACTTCCG
GCCAGTGCTGGACCTCACCTGCTACCTGACACTACTCACGGCGATATTGAACAGGCT
TGCGCTACTGCTCCGTTCCCTGTTCTTACTGCTCTTCCGGGACCCGCTACATCTGTTGCTCCA
GT
CCCACCATCGTGA

Retrieve as FASTA