Entry information : AtAPx07 (At4g09010 / APX4 / THYLAKOID_LUMEN 29 / TL29)
Entry ID 3920
Creation 2006-09-08 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-15 (Christophe Dunand)
Peroxidase information: AtAPx07 (At4g09010 / APX4 / THYLAKOID_LUMEN 29 / TL29)
Name (synonym) AtAPx07 (At4g09010 / APX4 / THYLAKOID_LUMEN 29 / TL29)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Thylakoid lumen
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPx07
start..stop
S start..stop
BstrAPx07 673 0 1..349 1..348
CrubAPx07 657 0 1..349 1..344
CagraAPx07 637 0 1..349 1..347
AlyAPx07 635 0 1..349 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5779243..5779338 96 N° 2 5779062..5779163 102 N° 3 5778825..5778912 88 N° 4 5778643..5778743 101
N° 5 5778533..5778573 41 N° 6 5778327..5778457 131 N° 7 5778127..5778233 107 N° 8 5777911..5778048 138
N° 9 5777698..5777832 135 N° 10 5777502..5777612 111  
complement(join(5777502..5777612,5777698..5777832,5777911..5778048,5778127..5778 233,5778327..5778457,5778533..5778573,5778643..5778743,5778825..5778912,5779062. .5779163,5779243..5779338))


exon

Literature and cross-references AtAPx07 (At4g09010 / APX4 / THYLAKOID_LUMEN 29 / TL29)
Literature REFERENCE 1 Spiegel,L.A., Huang,E.N., Nascimento,L.U., de la Bastide,M., Vil,D.M., Preston,R.R., Matero,A., Shah,R., O'Shaughnessy,A., Rodriguez,M., Shekher,M., Schutz,K., See,L.H., Swaby,I., Habermann,K., Dedhia,N.N., Mewes,H.W., Lemcke,K. and Mayer,K.F.X. Unpublished
REFERENCE 2 Robben,J., Grymonprez,B., Bastiaens,I., Volckaert,G., Mewes,H.W., Lemcke,K. and Mayer,K.F.X. Unpublished
REFERENCE 3
Lamar,B., Stoneking,T., Stumpf,J., Mewes,H.W., Lemcke,K. and Mayer,K.F.X. Unpublishe (16-APR-2005)
Protein ref. UniProtKB:   P82281
DNA ref. Phytozome 12:   Chr4 (5779338..5777502)
Cluster/Prediction ref. Phytozome Gene 12:   19647518
Omic ref. AtProteome:   At4g09010 ATTED-II:   At4g09010 e-FP Browser:   At4g09010 ePlant:   At4g09010 TAIR:   At4g09010
Protein sequence: AtAPx07 (At4g09010 / APX4 / THYLAKOID_LUMEN 29 / TL29)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349
PWM (Da):   %s   37797.46  
PI (pH):   %s   8.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGVSFLSTVPSFTNTTNHQHLTTLSSSSHRSAVIRCSKIEPQVSGESLAFHRRDVLKLAGTAVGMELIGNGFINNVGDAKAADLNQRRQRSEFQSKIKILLSTTIKAKPELVPSLLKLALNDAMTYDATKSGGANGSIRFSSELSRAENEGLSDGLSLIEEVKKEIDSISKGGPISYADIIQLGQSAVKFTYLASAIRKCGGNEEKGNLLYTAYGSAGQWGLFDRNFGRSDATEADPEGRVPQWGKATVQEMKDKFIAVGLGPRLAVMSAFLGPDQAATEQLLATDPQVAPWVQKYQRSRETVSQTDYEVDLITAFTKLSCLGQQINFEAYTYPVERINLSKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA and 15 ESTs (TIGR, UniGene At.22637). According to Teixeira FK et al. (J.Mol.Evol. (2004) pp. 761-770), it is not an APx, as it lacks heme-binding site, active site and is more distant to other APx proteins than CCP.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AATTAGTAAC TAGATAATGC CAAATTGTTT GGAAGTTAGA TATATGTAAT AAGGAAGCAA TTTACATGAC TTTAAGAGAC CTGATTCTTT AAGAGGAAAG CTAAGAATTT GAACTGAATT  TTGGCAAATT GGTCATCATA GCATTGTTGT AGATGTATAT CATAAAGTAT TTGCATTTTT CCGTTCTTTC TTTTACTTTT TCTCTAAATT TGTGACAATG GTTTGCATGA GGATATGTTG  TGCAGCCAGA TAAATTGCCA AACTACGTAG TCCCTGATTT GACTGGCTTT AAGGTTTTTA TTCTACCCTA AACTCTTCTG TTACTTTTCT TTGATTCCTC GATATTGAAC ATGAGAACAA  AACAATAGTG AATTCCTTCG GATATCTTTT TACAAGTCGT AAACTTGTAA TGGTTTGAAG CTCCTTAGGT TTGTGATCCT GATGATCTTA TTCGTTTTAG GTTGTGTTAG GAACCTGAAA  TGGAATGCTT ACTTCTTGCA TTAACCTTGT TGTGTTTTGC ATGCCACCCT AAATTCTTCT GTTCCTTTCC TTTGATTCCT CTATATAGAT AGCCGAGTAT GTAACTTGCA TCCTAATTGA  ACATTAGAAC AAATTCCCTT TTTAAACCGT TTACATGTCT TACTATTCAA AGCTCCTTAA GCATGTGTGA TCCTGACGAT TTTTTTTCCG GTCTTAAGTT TTGTGTTAGG AACCTGAAAT  AGAATGCTAG CTTAATGTAT AACGCAAGCT TTGTTGTGTG ATCTAGCTTT GCTGATGGAA CATTTGTATT TTATAGCTGA AACCATATGT ATCTCAGTGC CCTTTAGACG TCAACAAAAC  AAACGAGTCA ACTGAAGCTT CCAAGTGACG AAGTTAGAAG AAACATGTTT TTAACTTTGA AGTCTTCATT AGCTTAAAGT TAAGGACTGT GTTATTCTAT CATCCTTAGA TATCTTTTGT  TACTCAACAA CTCCTAGCAA GTTATTTCGA GATTGAGTTA ATAAAATAAA AACTTTGAAT TGAATCCAAT GAATCTTAGA TTTCAATATT TCTCCACTTC TCAATTCCCT GTTTGGTAAC  TGCTACTGAA TGTGTGTACC GTTTCTATTG TAACCAACAG GTAAAACGGT AAATTAAAGC GGGACAATGA ATAAAAATCC TCAAAAACCC CAAAAAATAC TCATACTAAT TTTTATTTGC  AAGTTTAATA CCCAATATTT TTGGATTGGA ATCAAAAATA CTTCATCTAA TATTTATGGT CATAAAATAC CTCATATATT TATTATTGGT AGAATGAAAC CCGCACAAAA TTCATGTTTT  TTTTCTCCCG TTTCTCTAAT TCTAGCCGAC GTAGATGATA CTCCCCGCAA GTAACATGTG CCTTATAATG TGATCGCGTT AGTTCCCAGC TTTGTCTAGC CACCAAGAAT CATCGTCTAT  GCCGCCTGCC GTCATAGCTC TAGGGAGGAG CTGAGAGTGA GAAGGACAAG GGAAAAAATG AGAATCTCTG AAGTTGGATT GGGTGTTTTA CTGGGATTAG TGGCATTCGA TAAGTTAGTA  ACACCGAATT GTATATATAG ATTAAAAAGT ATGAGATTCA AATTTAACCC CGTTAAATAG TTCCGTTAAC GTCCGTTAAG CCGTAGGTTA ATTCTAACAA TAATTAATAT ATGAGGTATT  TTATGACAGT AAATAATTAG ATAATTTATT TTTATACCAA TTCAAAAATA TTGGGTATTA AACTTGCAAA TAAAAATTAG TATGAGTTTT TTTTGGGATT TTTAACCACA AAAAAAATCT  TTGACCTTTT AAAAAACTCT TATTGAAAAA AAAAAAAGGA GTTATATGAT GAAACCAAAT GGACCCATAT GATTGGGAGA TTTGGATAAC AGAGAATCCA CAAAAGTGTA TCCTTCACAA 
AACCAAAACA CACTCTCCAT TTTCTTCAGA CAACTCTTTC TCCTTTCTTC TCTCTTCTCT GTCTCATCAC AAACCAGAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCTATGTACA CTATATGTAT AACATGAGAG GAAACTTCGA AATAAACCAA AGATTTTTCT TGACATTGAA ACAAAAAGAG AAGTTGAATC CATTACAAAC AAAGACACAG AAGATAGGAG  TCAAATCACG ATAAAATGGA AACAGATAAA CGAAAAATAA TAGGAATCGA GTTTTCGTAT CCACGGTTGA GAAAAGCAGC AAAAAAGGAC AAGAATTAGA CTGCCTTAGA GAGCTTGGGG  ATAAAAGGAA ATAAGAAACC AACAGAGAAA CACCTCCAAG AGAAAAACAT ATTAATGGAG AGGTTTTAGA TACTGAAATG ACAACAAAGT TGCGGTAAGA CGACTTAGGA TTGTTGCTCG  TCAGCGGGTT TTGCTGCTGC TGGTGCTGCT TCTTTGATGT CATCAGCAAC ATCGTCCTGA TTGAAAAAAA CATTTGACAA GATCATCATA ATCAGAATCA GACCACAAGA AAGAAGGATT  GAGGAATGTA TCAAAATGTA AACTAAGCAA CAACTTGATT TCCAAATCTA GTCTCCCTCA ATGGCATATA TCTTGCTCAT GGTTTCAGAA ATCACAAACA GGCTTAAGCA AGGCATAAGG  AGGAATGCAT CAAAATGTAA ACTAAACCAC TTGATATTCA ATTCGTGTCT TCCTCAATGG CTTAACAAGG CTTATGATTT CATAAATTAA GCAACAAAAC AGGATTAAAC ACATTTGACA  ATCACTAAAA TCAGAATATG ACCAAGAGAA TGCATCAAAA TGTAAACTAA ACTGTTTGTT TTCCATATCT AGACTTCCGC AATGGCTTAA CAAGGCTCAT GGTTTCAGAA ATCAAGCAAC  AAAACAGGCT TAAATACATT TGACAATCAC TAAAATCAGA ATCAGAGCCA GCAGAATGCA TCCAAATGTA AACTAAACTG TTTTATTACA AATCAAGTCT TTCTTAATGG TTTAATTATA 
GGCTAAAAGT TTCAGAGATC AAGAAACAAA AACGTTATTC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGAGTGTCCTTCCTCTCCACTGTTCCTTCCTTCACCAACACAACCAATCATCAACATCTCACTACACTCTCTTCTTCTTCTCATCGCTCTGTGAGTTTCAACCATTGTTACATT
CTTTACTTCTAACCCATTTTACATTTCTTCTGCTAACAATTCTTCTTCTGATCAGGCTGTTATACGATGTTCCAAGATTGAACCTCAAGTTTCCGGTGAAAGTTTAGCTTTCCACCGCCG
TGATGTTCTCAAACTCGCCGGCACTGCAGTCGGAATG
GTACCTTAACACTTGACTCGATCAAAAATTACATACACATTGGTACAAATGAGATATTGTAATGTATAGTCTGTGGCTACATC
TTCTTGAAGTTGTCCTCTCTATGTCACATTTGATGAGTTCTTGGCAGTGATGATCTCTCTTGTTAGGAATTAATAGGCAACGGTTTCATTAACAATGTGGGTGATGCAAAAGCTGCTGAC
TTGAATCAACGTAGACAACGATCCGAGTTTCAAT
GTGAGTATCTGAAACAAGAACACTAGTGTGGTACCATTAGGTTGTTATTGGCACTAAAGGTTTCACTTTTATATTATGCAGCAAAG
ATCAAGATTTTGCTTTCAACCACCATTAAGGCTAAACCGGAGCTTGTACCTTCCTTACTCAAACTAGCTCTCAATGATGCTATGACTTATGATAAG
GTCAGGCTTCATATAATGCTCTTG
TCCATCTCTCTGGTGACCCTTTAATGATACTAGCTTTTTGTCTAGGCTACTAAATCCGGGGGAGCCAATGGATCCATACGGTTCAGGTAGTTATATGATGTAAGAACATTATAAGAGTAA
TCTTTAGATGATGTCTAATGCATTCTTTTCTTTTTGTGAAGCTCTGAGCTAAGTAGAGCAGAGAATGAGGGACTTTCTGATGGGTTGAGTTTGATAGAGGAAGTGAAGAAGGAGATTGAC
TCTATCTCGAAGGGAGGTCCTATTTCATATGCAGATATCATTCAATTAGCAG
GTAATGTTATAGTATATACCAAAACTTGTTCATGAAGAGTAGCATTATTGTATTTGTGGATAACTGAA
ATCTTTCTTGGGTTGGTTTCTGTAGGACAATCAGCGGTCAAGTTTACATATTTAGCATCGGCTATCCGAAAATGTGGTGGAAATGAAGAGAAGGGGAACTTACTTTACACAGCATATGGT
TCAGCTGGTCAG
GTAAACAATGCTATCGTATTCGCTTTTGAGTCGCGGCGTTTTGTTCAAATCGATACTGAACCGTTGTGAATCTGTTAGTGGGGATTGTTTGATAGAAATTTTGGAAGG
AGTGATGCAACAGAGGCTGATCCAGAAGGCAGAGTCCCACAATGGGGGAAAGCAACTGTGCAAGAGATGAAAGATAAGTTCATTGCTGTTGGATTGGGTCCTCGTCAG
GTACATGATTTT
CGGTTTAAACAGAGAATTATCTACTAGGATCACTCGAAGTAACTAACCTGTATGAGGAATTTGTAGCTAGCTGTAATGTCTGCATTCTTGGGTCCTGATCAAGCTGCAACAGAACAGCTC
TTAGCTACTGACCCTCAAGTTGCTCCATGGGTTCAGAAGTATCAAAGAAGCCGTGAAACCGTATCTCAGACTGATTACGAG
GTTCGTTTTCACTCGATTTGCCTTAATCATATATTCATC
TACCTCAAACTCAAGCTCATGTTTTGGTTTATGAATATGTTTGTAGGTTGATCTCATAACTGCATTCACAAAGCTAAGTTGCTTAGGACAGCAAATCAACTTCGAGGCATATACATATCC
CGTCGAACGGATCAATCTGAGCAAACTCAAGCTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGAGTGTCCTTCCTCTCCACTGTTCCTTCCTTCACCAACACAACCAATCATCAACATCTCACTACACTCTCTTCTTCTTCTCATCGCTCTGCTGTTATACGATGTTCCAAGATT
GAACCTCAAGTTTCCGGTGAAAGTTTAGCTTTCCACCGCCGTGATGTTCTCAAACTCGCCGGCACTGCAGTCGGAATG
GAATTAATAGGCAACGGTTTCATTAACAATGTGGGTGATGCA
AAAGCTGCTGACTTGAATCAACGTAGACAACGATCCGAGTTTCAAT
CAAAGATCAAGATTTTGCTTTCAACCACCATTAAGGCTAAACCGGAGCTTGTACCTTCCTTACTCAAACTAGCT
CTCAATGATGCTATGACTTATGATAAG
GCTACTAAATCCGGGGGAGCCAATGGATCCATACGGTTCAGCTCTGAGCTAAGTAGAGCAGAGAATGAGGGACTTTCTGATGGGTTGAGTTTG
ATAGAGGAAGTGAAGAAGGAGATTGACTCTATCTCGAAGGGAGGTCCTATTTCATATGCAGATATCATTCAATTAGCAG
GACAATCAGCGGTCAAGTTTACATATTTAGCATCGGCTATC
CGAAAATGTGGTGGAAATGAAGAGAAGGGGAACTTACTTTACACAGCATATGGTTCAGCTGGTCAG
TGGGGATTGTTTGATAGAAATTTTGGAAGGAGTGATGCAACAGAGGCTGATCCA
GAAGGCAGAGTCCCACAATGGGGGAAAGCAACTGTGCAAGAGATGAAAGATAAGTTCATTGCTGTTGGATTGGGTCCTCGTCAG
CTAGCTGTAATGTCTGCATTCTTGGGTCCTGATCAA
GCTGCAACAGAACAGCTCTTAGCTACTGACCCTCAAGTTGCTCCATGGGTTCAGAAGTATCAAAGAAGCCGTGAAACCGTATCTCAGACTGATTACGAG
GTTGATCTCATAACTGCATTC
ACAAAGCTAAGTTGCTTAGGACAGCAAATCAACTTCGAGGCATATACATATCCCGTCGAACGGATCAATCTGAGCAAACTCAAGCTATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAGATTTGG ATAACAGAGA ATCCACAAAA GTGTATCCTT CACAAAACCA AAACACACTC TCCATTTTCT TCAGACAACT CTTTCTCCTT TCTTCTCTCT TCTCTGTCTC ATCACAAACC  AGAAATGGGA GGAGTGTCCT TCCTCTCCAC TGTTCCTTCC TTCACCAACA CAACCAATCA TCAACATCTC ACTACACTCT CTTCTTCTTC TCATCGCTCT GCTGTTATAC GATGTTCCAA  GATTGAACCT CAAGTTTCCG GTGAAAGTTT AGCTTTCCAC CGCCGTGATG TTCTCAAACT CGCCGGCACT GCAGTCGGAA TGGAATTAAT AGGCAACGGT TTCATTAACA ATGTGGGTGA  TGCAAAAGCT GCTGACTTGA ATCAACGTAG ACAACGATCC GAGTTTCAAT CAAAGATCAA GATTTTGCTT TCAACCACCA TTAAGGCTAA ACCGGAGCTT GTACCTTCCT TACTCAAACT  AGCTCTCAAT GATGCTATGA CTTATGATAA GGCTACTAAA TCCGGGGGAG CCAATGGATC CATACGGTTC AGCTCTGAGC TAAGTAGAGC AGAGAATGAG GGACTTTCTG ATGGGTTGAG  TTTGATAGAG GAAGTGAAGA AGGAGATTGA CTCTATCTCG AAGGGAGGTC CTATTTCATA TGCAGATATC ATTCAATTAG CAGGACAATC AGCGGTCAAG TTTACATATT TAGCATCGGC  TATCCGAAAA TGTGGTGGAA ATGAAGAGAA GGGGAACTTA CTTTACACAG CATATGGTTC AGCTGGTCAG TGGGGATTGT TTGATAGAAA TTTTGGAAGG AGTGATGCAA CAGAGGCTGA  TCCAGAAGGC AGAGTCCCAC AATGGGGGAA AGCAACTGTG CAAGAGATGA AAGATAAGTT CATTGCTGTT GGATTGGGTC CTCGTCAGCT AGCTGTAATG TCTGCATTCT TGGGTCCTGA  TCAAGCTGCA ACAGAACAGC TCTTAGCTAC TGACCCTCAA GTTGCTCCAT GGGTTCAGAA GTATCAAAGA AGCCGTGAAA CCGTATCTCA GACTGATTAC GAGGTTGATC TCATAACTGC  ATTCACAAAG CTAAGTTGCT TAGGACAGCA AATCAACTTC GAGGCATATA CATATCCCGT CGAACGGATC AATCTGAGCA AACTCAAGCT ATAAGCTATG TACACTATAT GTATAACATG 
AGAGGAAACT TCGAAATAAA CCAAAGATTT TTCTTGACAT TGAAACAAAA AGAGAAGTTG AATCCATTAC AAACAAAGA 

Retrieve as FASTA