Entry information : MeAPx03 (APx3-APx2)
Entry ID 3925
Creation 2006-09-22 (Filippo Passardi)
Last sequence changes 2006-09-22 (Filippo Passardi)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MeAPx03 (APx3-APx2)
Name (synonym) MeAPx03 (APx3-APx2)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MeAPx03
start..stop
S start..stop
HbAPx01 474 8e-173 1..250 1..250
MeAPx06 461 1e-167 1..250 1..250
AaAPx02 445 5e-161 1..250 1..250
FaAPx01-1 438 2e-158 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 151017..151135 119 N° 2 150753..150927 175 N° 3 150589..150654 66 N° 4 149887..149935 49
N° 5 149703..149788 86 N° 6 149515..149594 80 N° 7 149304..149406 103 N° 8 149155..149213 59
N° 9 149058..149070 13  
complement(join(149058..149070,149155..149213,149304..149406,149515..149594,1497 03..149788,149887..149935,150589..150654,150753..150927,151017..151135))


exon

Literature and cross-references MeAPx03 (APx3-APx2)
Literature Reilly,K., Bernal,D., Cortes,D., Gomez-Vasquez,R., Beeching,J.R.
and Tohme,J.

Knowledge and tools for the modulation of post-harvest
physiological deterioration in cassava

Unpublished (18-APR-2005)

Protein ref. UniProtKB:   Q52QX1
DNA ref. Phytozome 12:   scaffold00506 (151135..149058)
mRNA ref. GenBank:   AY973623
Protein sequence: MeAPx03 (APx3-APx2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27580.9  
PI (pH):   %s   5.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPKNYPKVSEEYQKAIDKARRKLRGFIAEKGCAPLMLRIAWHSAGTYDVKTNTGGPFGTMRHAAEQGHAANNGLDIAVRLLEPIKEQFPILSYADFYLAGVVAVEITGGPDIPFHPGREDKPEPPPEGRLPNATKGADHLREVFGKTMGLTDKDIVVLSGGHTGRCHKERSGFEGPWTPNPLIFDNSFFQVLLDEPTEDLLQLPTDSVLVTDPVFRPYVEKYADEEAFFADYAESHMKLSELGFAE

Retrieve as FASTA  
Remarks Complete sequence from genomic and mRNA. No prediction from phytozome. Cultivar="CM21772".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAAGAACTACCCAAAAGTTAGTGAAGAGTACCAGAAAGCCATTGATAAGGCCAGGAGGAAGCTCAGAGGTTTCATCGCTGAGAAAGGCTGCGCTCCTCTCATGCTCCGTATCGCG
TATGTTATTTCTTTCTTTCTATTTCTCTTCGGGCATATGATTTTTGTATGCGAGATATTTTGTGGTAATATGTTACGGTGGTGTGCAGATGGCACTCAGCTGGAACTTACGACGTGAAGA
CGAACACTGGAGGTCCTTTTGGAACCATGAGGCACGCAGCGGAGCAGGGTCATGCTGCTAACAATGGGTTAGATATTGCTGTTAGACTCCTTGAGCCCATCAAGGAGCAGTTCCCTATCC
TCTCCTACGCCGACTTCTATCAG
GCATGTCATGATACAACTATATGAATTTACGATCGGTTCCTCACTAATTGATTTACTGGTCATTTTGTTGATTTCTGATTTGATGTCGATATGTGTA
GCTCGCTGGTGTTGTTGCCGTTGAGATCACTGGTGGGCCTGATATCCCATTCCACCCAGGAAGAGAGGTCAGTCTACTGCTCTAGTCTTTGAGGAAAAAAAAAAGTCTACTGCTCTAGTG
GGTGTCCTTTTATTAATATAGATTTCCATTTATGCCCCCTTTGTCTTTAATATAATTTTTGCCGAATAATGATGTCGAGAAAGAAAGAAAAACTTGCTTCGACTAGGTCTACCATGTGGT
ATAGAGTATATAAAGTTTCACTATTATTTAAGTGGTCCACCTCACCTGTCTAGATAAGACATGTAAAGCTGTAAAATAATCCCTGTGATTTGGCTTTTTTGACGTACTGAAAACTGCTTT
ATTTAAATGGACAAATAATTACAACTCTAAAACCACAAGAAAGTACTCTCATTTTCTCAATAAAATCTACACTAAAACTTACATCGTAATCCTAAGCCCCTTGTGTGTTTGATTATCATT
TTTCTTGAATTTCTGCATAGGTGCCTGCTTGGCAGTGCACGAGGTTATATGTTCAAACCATGTCAGTCCCCCCACCCTTCAAGAATTTCTGTAGTACCCCCAAAAAAATCCTGTATTGAT
TTTCTGTAGAGTTCTTTAAATTCCTCAGTGTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNTGCACGTGTGTGGATTTTACTTTTTCAGCCGGTATTAACGGTGACCCTTGCTGTCTCAG

GACAAGCCTGAACCGCCTCCAGAAGGTCGTCTCCCTAATGCTACTAAAG
GTTAGCTTCTTCCACAATTGTATCATTGAAATTTAGAAGCTTGTCTGCGTTTTGTTTGTATACGAGGTTTG
TTCCTAAGTTGAGAATCATTGTTTCAGGTGCTGATCACTTGAGAGAGGTCTTTGGGAAAACCATGGGTCTCACCGACAAGGATATTGTTGTCCTTTCTGGTGGCCACACCTTGGTTAGTG
TTGAATTTTGAATTTAACTGATCTTATTGTTAATAATTAATAAATTTCTGACGTTTTTCACTGATTCCTACTAATTGTCTTGATGGGGATGACAATTGTAGGGAAGGTGCCACAAGGAAC
GCTCTGGTTTTGAAGGTCCCTGGACTCCTAATCCTCTCATCTTTGACAATTCCTTCTTCCA
GTGAGTTGTCTATCTTGTTTGCTGGCATACTTATTCTGCCAACAGTAGCTAGACAAATT
TTGTTGTTTACATTTGATGTAACTGACACTGCATTTCAAATATGTTTAGGGTGCTCTTGGACGAACCGACAGAAGATCTTCTACAATTGCCGACTGACAGTGTTCTTGTCACGGATCCTG
TCTTCCGCCCATATGTTGAAAAATATGCTGCT
GTGTGTATCCTTATTTTACAACCGAGTTCATGTTTGATAATTGGTAATAATTGCTGGGGTGCTGATAATTATCTCCATCTCCGAATGC
AGGATGAAGAGGCATTCTTTGCTGATTATGCTGAGTCCCATATGAAGCTCTCTGAGCTCGGGTAACTTCAATTCTCAATCCTGCATTGTTCTGTTAATTTTAGGACTCCTTTTTCACTGG
GCTCATCATGTGTACTGTTTTGCAGATTTGCTGAGGCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAAGAACTACCCAAAAGTTAGTGAAGAGTACCAGAAAGCCATTGATAAGGCCAGGAGGAAGCTCAGAGGTTTCATCGCTGAGAAAGGCTGCGCTCCTCTCATGCTCCGTATCGCA
TGGCACTCAGCTGGAACTTACGACGTGAAGACGAACACTGGAGGTCCTTTTGGAACCATGAGGCACGCAGCGGAGCAGGGTCATGCTGCTAACAATGGGTTAGATATTGCTGTTAGACTC
CTTGAGCCCATCAAGGAGCAGTTCCCTATCCTCTCCTACGCCGACTTCTATCAG
CTCGCTGGTGTTGTTGCCGTTGAGATCACTGGTGGGCCTGATATCCCATTCCACCCAGGAAGAGAG
GACAAGCCTGAACCGCCTCCAGAAGGTCGTCTCCCTAATGCTACTAAAGGTGCTGATCACTTGAGAGAGGTCTTTGGGAAAACCATGGGTCTCACCGACAAGGATATTGTTGTCCTTTCT
GGTGGCCACACCTTG
GGAAGGTGCCACAAGGAACGCTCTGGTTTTGAAGGTCCCTGGACTCCTAATCCTCTCATCTTTGACAATTCCTTCTTCCAGGTGCTCTTGGACGAACCGACAGAA
GATCTTCTACAATTGCCGACTGACAGTGTTCTTGTCACGGATCCTGTCTTCCGCCCATATGTTGAAAAATATGCTGCT
GATGAAGAGGCATTCTTTGCTGATTATGCTGAGTCCCATATG
AAGCTCTCTGAGCTCGG
ATTTGCTGAGGCG

Retrieve as FASTA