Entry information : PpaKat01
Entry ID 393
Creation 2008-11-26 (Christophe Dunand)
Last sequence changes 2008-11-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: PpaKat01
Name PpaKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue types Chloronemata
Gametophore
Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaKat01
start..stop
S start..stop
PpaKat02 982 0 1..492 1..492
SsKat02_AU1 893 0 1..492 1..492
SsKat01_AU1 877 0 1..484 1..484
PsyKat01 875 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2111624..2111638 15 N° 2 2110576..2110672 97 N° 3 2110114..2110451 338 N° 4 2109697..2109879 183
N° 5 2109295..2109564 270 N° 6 2108675..2108938 264 N° 7 2108410..2108499 90 N° 8 2108164..2108231 68
N° 9 2107860..2108013 154  
complement(join(2107860..2108013,2108164..2108231,2108410..2108499,2108675..2108 938,2109295..2109564,2109697..2109879,2110114..2110451,2110576..2110672,2111624. .2111638))


exon

Literature and cross-references PpaKat01
Literature Rensing S.A., et al., The physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319:64-69(2008).
Protein ref. UniProtKB:   A9RDR1
DNA ref. Phytozome 11:   scaffold_3 (2111638..2107860)
Cluster/Prediction ref. UniGene:   Ppa.3891
Protein sequence: PpaKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56806.15  
PI (pH):   %s   7.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSQYDTPFWTTNQGAPVWNNNNSLTVGPRGPVLLEDYHLVEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNFDMVGNNIPVFFIRDGIFPDMIHALKPNPKSHIQEPWRIMDFFSHVPEACNMFTFVFDDIGIPADYRHMEGFGVHTFKLITKAGKETYVKFHWKPTCGVKSLLDEEAVMVGGANHSHATQDLYDSIASGNFPEWKLMIQTMNPADEDKFDFDPLDDTKIWPEDMFPLQPVGRMVLNRNIDNFFAENEQLAFCPGVIVPGIYYSDDKMFQTRIFSYSDTQRHRLGPNYLMLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRFDPVRHSERVPVSQSRLLGIREKAVIHKENNFQQPGVRFRSFDPARQDRFIKRIIELLSDPRVTHEVRSVWVAYWSQCDKTLGQRIASHFSMKAAM

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 113 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGTGAATTCCCGCTGCCAACGCGATAACCTTGATGCGTGTTGGCGTTGATTGTTTTTTTCTCGATTTTGTTGTGTTGCGTACAACGATCGCAGTTCTCTCGTGGGA
ATTATGTTAGCGTAACCAGTATTTGTTGCTCTTCGGATTGTGTCATCTGGGACGTATGAGAATTACCTTCTCGTGTTTTTATTGCCCTTCAATTGTTTATTATTTTGAAATTTAGATGTT
GGGTTTCAATATGAAACATTCGTGAGTAGGACCGCAGTGGTTTCGGTGTTGATGAGGTCTTGTCTTGGATTGTCTGCATGAATTGAATTGATTTCGAGCTTTGTGAAAATAACGTTTCTT
AAAACGTTTATCACAGACCAGTTAGCGGTGCCGCGAAGGTCTTACGTCCGTAGATTTTGGTCGTCTGATTTACATATGATTTCTTATTTGAAGAATGTTTTTCGGCGAGCAAGCAAAAGC
ATGCTGTGAGATTACGTTGTTTCGTCTGGTTTCAAAATTGTCAGTACTCGAAGGTATTAAAGTGATTGGGAACAGTGATGTGGATTCTGAGAGTTGTATCCGATATAACTTGCATGCTCC
GATCAACTGTGGATTTCTCGAGTACTAGTGGTTTTGTGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTATGGAGTATGTCTTCAGGTTTCAAAGTTAATCTTTGCC
TTTGTATGTTCCTTCATTGAGTAATTTATCTGTGTGATTGAGATACACTTGTGTAAATTATAAACTTACTTTTGAGGGTTTTAATGCTGGTAACGACACTGCAATGTTTTCACGGCTGGA
TTGAAATAGTGAAGAGCGTGGTGTAGTGTAATCACCTTTGGTTAAGTTGTTTTGGTTTGTGCCAGTCTGACAGATTTATTTGCTTGTAAATGGTTGTTTTACCGAATTTGCTGTGTTTGG
ATACAGTATCGGCCATCTAGCCAGTACGACACACCATTTTGGACCACAAACCAGGGAGCGCCAGTATGGAACAACAACAATTCTCTCACAGTTGGTCCTAGAGGTAAGCATATTTTCAGT
GGGACATTGGTCGAACTAGTGTTGGGTAACTTGTAAGCAATCTTTTGCGGCAGAGTTGTTGAACCATACCTGTTAGGGCACTTCTTGACTACTCTTCTTTTATCCAGGTCCGGTCCTCTT
GGAGGACTACCATTTGGTGGAGAAGTTGGCGCAATTTGATAGAGAGCGCATTCCAGAGCGTGTGGTGCATGCACGAGGTGCTAGCGCCAAGGGTTTCTTTGAGGTTACACACGACATTTC
GCACCTCACATGTGCCGATTTCTTGAGGGCACCTGGTGTGCAGACCCCGGTGATTGTTCGCTTCTCAACTGTGATCCACGAAAGAGGAAGCCCTGAGACTCTTCGTGACCCGCGTGGATT
TGCCGTCAAATTTTACACTCGAGAGGGTAACTTTGATATGGTCGGCAACAACATTCCAGTATTCTTCATTCGAGATGGGATTAAG
GTACATCACATAAGGAACTTACACTCACTTTATTG
GGATGCAAAGTGAAATGGGGGATTTCCTTCTTTTGCTGCTGAGTGATGAACTTAAGGCTATGTTTATGGTTTATATGGTGAATTAGAAGCCAGTTTTAGTGAACACATGAATTAAGCTTA
AGTTGGCGCTTGGAGCTAGTATCCTCACCTAGTGATTTTCCGTCTTCGTTATATTGATGGTGACTTTGTTTTTGTACAGTTCCCTGATATGATTCACGCCTTGAAGCCGAACCCCAAGAG
TCACATTCAGGAGCCATGGCGTATTATGGATTTCTTCTCGCATGTCCCTGAGGCCTGCAATATGTTCACTTTTGTGTTTGATGACATTGGTATTCCGGCAGATTATCGCCACATGGAGGG
TTTTGGTGTCCACACCTTCAAG
GTTGGTTTTGATAACTTGTTCTCACACAGGATTTGTAGACGAATTTCATTTTTTGAATTCTGTAAACGATCTAGTGGGGATTGGGCCTCCCTATGTAT
GTTGCCATTCTGATGATAATGTGTATTGGCGCAGTTGATTACCAAGGCTGGCAAAGAAACTTATGTAAAGTTCCACTGGAAGCCCACTTGTGGTGTAAAGAGCCTGTTGGATGAGGAAGC
CGTTATGGTTGGAGGTGCCAATCATAGCCATGCTACCCAGGACCTCTACGATTCTATTGCTTCTGGGAACTTCCCCGAGTGGAAGCTCATGATTCAGACAATGAACCCGGCTGACGAAGA
TAAGTTTGATTTTGATCCTCTGGATGATACTAAGATTTGGCCTGAGGACATGTTTCCCCTTCAG
GTATGTCTCCCTTAACGTTGGTTTCTTTTCTTTTTCTAGTCGGCAAAAAGTCAAGT
GTCTTAATTGGTGGGTGAAGGCCACAGTCAACTGTAACAAGTCCTGCTGTCTTGTGAATTCCCGAGCTTAGCTGAGCTGAGTTCTTGTCAGCTTACTAGTATTTGCGAGTGAATTAGAAC
TTGTTATAAATGGGTCTTAGATAATGAGTACATGTTTGATAGGTTTTTTTAAGGTGCGAATTAGGCGGTTCTGAAACCCTAAGTTGTGCATTTTGCTCTAGCTCATTTAATTTATATCAG
TTGGAACTTCATTCAGTTCATTCGCTTATAATATATGTGAAATTTTGGTGTTGCACGCAGCCTGTGGGAAGGATGGTGCTGAACAGGAATATCGACAATTTCTTCGCTGAAAATGAGCAG
CTAGCTTTCTGCCCTGGTGTTATTGTTCCTGGAATCTATTACAGCGATGACAAGATGTTTCAGACTCGTATCTTCTCTTACTCAGACACTCAGCGCCATCGCTTGGGTCCTAATTACCTC
ATGCTGCCTGTTAATGCTCCTAAATGTGCACACCATAACAACCATCACGAAGGTTTTATGAACTTCATGCATCGTGATGAGGAG
GTAAGTGTAGCAATCATCCTACTTTTTGCAAAGTTG
AAGACTCAGAATTTGTGCTCCAACTAATTATTAGCTAATTAGTTTTACTTTTCCCTCCGCAACAATGCATTGTTCAGTGTATGTGAATTTTGAAGCAAAATATCCCACACTGATATTAGG
AGATTATTTTTATATGCAGGTGAATTATTTTCCGTCACGATTTGACCCCGTTCGCCACTCAGAACGCGTTCCAGTTTCACAGAGCAGACTCTTAGGAATCAGGGAGAAGGTAATGCTTTG
TATATAGTCTATTTAATGGATATTGGTTTAGAAATTGTTTTTGATCAATCTAGGCATACTTATTTTGGTTTTGTGGAACTAAATTGTATACTTCAAAGCCTGTGAAAAGTTACACATTGA
GTTCTGGAGTTTAAAGTTATTTATGGAGTGTAAACTTATTATGGCAGGCTGTCATTCATAAAGAGAACAATTTCCAACAACCTGGAGTCAGGTTCCGGTCCTTTGATCCTGCTAGGTACG
ATTTTTTCTTCCTTGATCAACGTTTGAAATTTCTTGTACAAAATTGTTCTTAGCAAGTGTGATATATCTTTGCTGCAATCGACAGCTACAGTGACCAAGTGAGTTGAACGTGAAGGAATT
GACTCGTGCTTTGGTATTTCTACAGGCAAGACCGTTTTATTAAGCGCATCATTGAGTTGCTATCAGACCCCAGAGTGACTCATGAAGTCCGTAGCGTGTGGGTTGCGTACTGGAGCCAGT
GTGACAAGACATTGGGCCAGAGGATTGCCTCACACTTCAGCATGAAGGCAGCCATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGTATCGGCCATCTAGCCAGTACGACACACCATTTTGGACCACAAACCAGGGAGCGCCAGTATGGAACAACAACAATTCTCTCACAGTTGGTCCTAGAGGTCCGGTC
CTCTTGGAGGACTACCATTTGGTGGAGAAGTTGGCGCAATTTGATAGAGAGCGCATTCCAGAGCGTGTGGTGCATGCACGAGGTGCTAGCGCCAAGGGTTTCTTTGAGGTTACACACGAC
ATTTCGCACCTCACATGTGCCGATTTCTTGAGGGCACCTGGTGTGCAGACCCCGGTGATTGTTCGCTTCTCAACTGTGATCCACGAAAGAGGAAGCCCTGAGACTCTTCGTGACCCGCGT
GGATTTGCCGTCAAATTTTACACTCGAGAGGGTAACTTTGATATGGTCGGCAACAACATTCCAGTATTCTTCATTCGAGATGGGATTAAG
TTCCCTGATATGATTCACGCCTTGAAGCCG
AACCCCAAGAGTCACATTCAGGAGCCATGGCGTATTATGGATTTCTTCTCGCATGTCCCTGAGGCCTGCAATATGTTCACTTTTGTGTTTGATGACATTGGTATTCCGGCAGATTATCGC
CACATGGAGGGTTTTGGTGTCCACACCTTCAAG
TTGATTACCAAGGCTGGCAAAGAAACTTATGTAAAGTTCCACTGGAAGCCCACTTGTGGTGTAAAGAGCCTGTTGGATGAGGAAGCC
GTTATGGTTGGAGGTGCCAATCATAGCCATGCTACCCAGGACCTCTACGATTCTATTGCTTCTGGGAACTTCCCCGAGTGGAAGCTCATGATTCAGACAATGAACCCGGCTGACGAAGAT
AAGTTTGATTTTGATCCTCTGGATGATACTAAGATTTGGCCTGAGGACATGTTTCCCCTTCAG
CCTGTGGGAAGGATGGTGCTGAACAGGAATATCGACAATTTCTTCGCTGAAAATGAG
CAGCTAGCTTTCTGCCCTGGTGTTATTGTTCCTGGAATCTATTACAGCGATGACAAGATGTTTCAGACTCGTATCTTCTCTTACTCAGACACTCAGCGCCATCGCTTGGGTCCTAATTAC
CTCATGCTGCCTGTTAATGCTCCTAAATGTGCACACCATAACAACCATCACGAAGGTTTTATGAACTTCATGCATCGTGATGAGGAG
GTGAATTATTTTCCGTCACGATTTGACCCCGTT
CGCCACTCAGAACGCGTTCCAGTTTCACAGAGCAGACTCTTAGGAATCAGGGAGAAG
GCTGTCATTCATAAAGAGAACAATTTCCAACAACCTGGAGTCAGGTTCCGGTCCTTTGATCCT
GCTAG
GCAAGACCGTTTTATTAAGCGCATCATTGAGTTGCTATCAGACCCCAGAGTGACTCATGAAGTCCGTAGCGTGTGGGTTGCGTACTGGAGCCAGTGTGACAAGACATTGGGCCAG
AGGATTGCCTCACACTTCAGCATGAAGGCAGCCATGTAG

Retrieve as FASTA