Entry information : AtAPx-R (At4g32320 / APX6)
Entry ID 3952
Creation 2006-09-08 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-15 (Christophe Dunand)
Peroxidase information: AtAPx-R (At4g32320 / APX6)
Name (synonym) AtAPx-R (At4g32320 / APX6)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPx-R
start..stop
S start..stop
AlyAPx-R 649 0 1..329 1..329
AhalAPx-R01 635 0 1..329 1..329
BstrAPx-R01 590 0 1..329 1..331
CagraAPx-R01 572 0 2..329 3..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15602777..15602960 184 N° 2 15603049..15603151 103 N° 3 15603260..15603375 116 N° 4 15603897..15603967 71
N° 5 15604126..15604168 43 N° 6 15604255..15604351 97 N° 7 15604445..15604528 84 N° 8 15604608..15604729 122
N° 9 15604870..15604936 67 N° 10 15605132..15605234 103  
join(15602777..15602960,15603049..15603151,15603260..15603375,15603897..15603967 ,15604126..15604168,15604255..15604351,15604445..15604528,15604608..15604729,156 04870..15604936,15605132..15605234)


exon

Literature and cross-references AtAPx-R (At4g32320 / APX6)
Literature Seki,M., Iida,K., Satou,M., Sakurai,T., Akiyama,K., Ishida,J., Nakajima,M., Enju,A., Kamiya,A., Narusaka,M., Carninci,P. Kawai,J., Hayashizaki,Y. and Shinozaki,K. Arabidopsis thaliana full-length cDNA.
Protein ref. UniProtKB:   Q8GY91
DNA ref. Phytozome 12:   Chr4 (15602777..15605234)
mRNA ref. GenBank:   NM_119384.4
Cluster/Prediction ref. Phytozome Gene 12:   19644159 UniGene:   At.31673
Omic ref. ATTED-II:   At4g32320 e-FP Browser:   At4g32320 ePlant:   At4g32320 Genevestigator:   At4g32320 TAIR:   At4g32320
Protein sequence: AtAPx-R (At4g32320 / APX6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329
PWM (Da):   %s   36103.6  
PI (pH):   %s   9.17
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTTASLVKTFLFRCDSFSSFKFKCKFESPAKTRLLSPATEKHVVRSSRAWRIRCLSDDPGSSHVFVASRRKMVVLLSTVQLLSHMLPQNGNAAEIYPVMQNEIRKVVTKGKAAGVLRLVFHDAGTFELDDHGGINGSIAYELERPENIGLKKSLVLAKAKVKVDEIQPVSWADMISVAGSEAVSICGGPTIPVVLGRLDSAQPDPEGKLPPETLSASGLKECFKRKGFSTQELVALSGAHTIGSKGFGDPTVFDNAYYKILLEKPWTSSKMTSMVGLPSDHALVQDDECLRWVKRYAEDQDKFFEDFTNAYIKLVNSGAKWNML

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 9 introns), 4 cDNA and 13 ESTs (TGI: TC254687 + TC268229). Low homology to other APx proteins. Ecotype="Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CATCTGCTGC CGATTCTTCG ACTAAAATAC CTAGCGATCT GTGCGGAACA CCTGAGCCTT GCGGGCCTTA CTATGTCTGC TCGGGTTCTA AAGTGTGTGG ATGTGTGTCC GGGTTGTCTC  GGGCTCGGTC TGATTGCAAA ACCGGGATTA CTTCTCCCTG TAAGAAAACC AAGGATAATG CAACATTGCC TTTGCAGCTA GTAAGTGCTG GAGACGGTGT AGACTATTTC GCTCTTGGGT  ATGCTCCTCC GTTCTCCAAG AAAACTGATC TTGATAGCTG TAAAGAGTTC TGCCACAACA ATTGCTCGTG CCTTGGTCTT TTCTTCCAGA ACAGTTCTGG TAATTGCTTC TTGTTTGATT  ATATTGGAAG CTTTAAAACC TCTGGCAATG GAGGCTCTGG GTTTGTGTCT TACATCAAGA TCGCAAGTAC TGGTTCTGGA GGTGGAGATA ACGGAGAAGA TGATGGGAAA CATTTTCCTT  ATGTAGTGAT TATTGTCGTG GTAACAGTTT TTATCATCGC TGTTTTGATC TTTGTGGCCT TCCGGATTCA TAAGAGAAAG AAAATGATTT TGGAGGCTCC TCAAGAGAGT TCAGAAGAAG  ATAACTTCTT GGAGAACTTA TCCGGGATGC CTATTCGGTT CGCTTACAAA GATCTTCAGT CAGCGACGAA TAACTTCTCG GTGAAGTTAG GTCAAGGAGG GTTTGGATCG GTCTATGAAG  GTACTTTACC AGATGGTTCT CGTCTAGCTG TGAAGAAACT TGAAGGAATC GGTCAAGGGA AGAAAGAATT CAGAGCCGAG GTTAGTATAA TCGGAAGTAT TCATCATCTG CACTTGGTGC  GGCTAAGAGG ATTCTGCGCA GAAGGGGCTC ATAGGCTGCT CGCATACGAG TTCTTATCCA AAGGTTCGTT GGAGAGATGG ATATTTAGGA AAAAGGATGG CGATGTTCTT CTAGATTGGG  ACACAAGATT TAACATAGCA CTCGGAACAG CCAAAGGTTT AGCGTATCTA CATGAAGATT GTGATGCAAG GATTGTTCAC TGCGATATAA AACCCGAGAA CATCCTATTA GACGATAACT  TCAATGCCAA GGTATCCGAT TTCGGACTGG CGAAGCTCAT GACCCGCGAA CAAAGCCATG TCTTCACAAC AATGCGCGGG ACAAGAGGCT ACTTGGCTCC AGAATGGATC ACAAACTATG  CGATATCAGA GAAGAGTGAT GTTTACAGCT ACGGAATGGT GTTGCTAGAG TTAATAGGAG GAAGAAAGAA CTATGATCCA TCAGAAACTT CGGAGAAATG CCATTTTCCT TCTTTTGCTT  TCAAGAAGAT GGAAGAAGGG AAGCTTATGG ATATTGTCGA TGGGAAGATG AAGAATGTTG ATGTGACTGA CGAAAGGGTT CAAAGGGCTA TGAAAACCGC ACTTTGGTGT ATACAAGAAG  ATATGCAAAC GAGACCCTCG ATGAGCAAAG TTGTTCAAAT GCTTGAAGGT GTTTTTCCGG TGGTCCAGCC ACCTAGTTCT TCCACTATGG GATCGAGACT TTACTCAAGC TTCTTTAAGT  CCATCAGCGA GGACGGCGGT GCTACTACGT CATCTGGACC GTCCGATTGT AACAGTGAGA ATTATCTCTC CGCCGTGAGA CTCTCCGGTC CGAGATAGCA ATCTTTTTAG CCAATTTTTA  GTATCTTATA TAATAGGTTT TTGGCTCACC ATGTTTTGTT GTATATTGTT TTTGTGTTAC ATCTTAAAAG AATAGCCATC ACTCAGTTTT GTAACGTTCC GAGATCAATT ATTTCATAGA  TTACCCGTCG TTTTTCTTAA CTGTCACAGA ACTCCATGTC GTTTTACATT CGGAATGCGT GCCGTGGTCT TCCTTCTCTC TATCCTACGT TCCTATTGGC TATAATGTTT TGCTTACTGT 
ACGCTTGTGG GTAGACAATG AAACTCCCGG TTCATAAATT TGAGCTAGGG TCTCGGAGAC TCTCGTCCCA CCGTTAAAG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATCTAATCT AGTTTTATAT TTTGTTAGCT CATAAGTGTT TCAAACATGC CCGAATAATT TGGGTAGTAA TGCTTATTTG CTAATAAGTA AAAATTTCGC TGCTTACTAG TTTACTACTA  CGAAACTAAA CATAAAAGAT ACTCAAACTT GACACCAACT TACTTCTATG CCACACCGAA TAATAAATTC GGTGTTTGAT TTGACTTTAC AAAACTAAAA CGATGACGAT TCTAGTCTTC  AGTGTTTGAA TTTTATTCAG CAGTCGGACG TTTTGACTTT TAACGAGACG CTAAAACCGC TACGATTTAT GTCGTTTAAG CAGTTATTTA TAAGTTAGGT CGAGTAGATT TTACAATTTA  TGTTTTGTTC ATGTAGTAAT TAGACACGAA GAAAAGGAAT AGGTCATGTA CGAATCGTCG TAGGTAGATG TAGTTTTTAT AGGAATATGC CGTTTCTATG TCAAAAGAGA TATTAACATG  TGTGTTTTGT CTAACAACCT ATTTTTTTTG GCTACTAGTC ATTATCTCTT ATTATTTAAA ATACATCGTG ATCAAAGAGT AGTACAATCG CATTCAATTG GATAAGATAA AATTTGATAT  GTGAATGGTG AAGCGAATCT TCCAACAAGG ATACACACCG ACCAACATAA AAGCAAAATC TATAATAAAA ACTGCTACCA TACTTCACAA TGTATAGAAA TCCAAGTCTC AAGGTGTTGC  GACTATTGCC ATACCACGTT GAGATACTAC TACTACTACA TGTATGCGAA AGTTCCAAAA AATAAAATAA TGGAAAAATG AACAATTAAG AATTGATACT CAAAAAGATT CATGGAATTA  AAAAAAAAAA AATTGATCTG AAAAAATTCA TTGATAACTA AAGTAGTATA ATCATTTTAC AATACTTATT TGTTATTAAA ACTATAATTC TAATTAACAA TTTACTAATT TAAATTATTT 
ATGAAAACAT TATTAGGATA TATCAGTTTT ATGAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTGCTTCTCTGGTTAAGACTTTTCTGTTTCGGTGCGACTCGTTTTCATCTTTCAAATTCAAATGCAAATTCGAATCTCCCGCGAAAACGCGATTGCTCTCTCCGGCG
ACCGAGAAACATGTTGTCAGATCGTCAAGAGCCTGGCGTATTCGTTGCTTATCCGATGATCCTG
GTAAGACCGGATTCTGGTTTCGTTGGCCATTGCTATTTTACTGTTTTCGTTTTCTT
CGACTTGTCCTGGCTAATTGCATAATTTGTAGGTTCGAGTCATGTTTTCGTTGCAAGTAGAAGGAAAATGGTAGTCTTGTTGTCGACGGTGCAGCTTCTGTCTCATATGCTTCCGCAAAA
CGGGAACGCAGCTGA
GTGAGTTTGAACAAATCCTTAATTTTGTGTAATTGACTCTGAATTTGGTTTTTGTTCAAATTATAGTTTTCCAATTTTTTTGTACTAAATTGATAGTTGGATTTT
CAGGATTTATCCGGTGATGCAAAACGAAATAAGGAAAGTGGTGACAAAGGGCAAGGCTGCTGGTGTGCTTCGTTTAGTGTTTCATGATGCTGGAACCTTTGAACTGGACGATCATTCTGG
TAACTTTCCATGACTCTTATGTATTCTGTAATCATCAGAATTTTACTTTCAAGTATAGTATATCTGACTCGTTTGTCAAGTTGCTATTTTGTATAAGTTAGATTGTTTCCTTCATTGTAA
ACTCAACATAGGTGAACATGGATATAGATTTGAAAGTTCCTTTATTTGTTCACTGGTTGGTGATAGACAAGTTTGCAAATGTAAAAATTGTTTGTTAGATTTATGTTTAGAATGGAATCT
GTGAATTTTTGGATGTTTTGGGTAGCTTGTGAATGTTTATTGGCTTAGTTTAATAGACTATCAAGTATTGTGAGAACTGGTTTGTTCAGTGGCTCTCTCAGGATGTTCTTATCATTTTAC
AATTTAATATACCTCAGTTTTGGCTTTGATGAACCAAGCTTGGTTGGTTTAGGTTCAGGTCTTTGCGATTTAGTATACTTCTGCTGGTATTTTCCTTTGTTCTCATTGAAAGATACTGTA
ACTATGTCTTAGTTCTTCTTGGTAATGAATTCAATTGCAGGTGGCATCAACGGATCTATTGCTTATGAACTTGAGAGACCTGAGAACATAGGTTTGAAGAAATCCTTAAAGGCACTAAAT
CCCTCTCTTTTATCTGTTGGCGTGAGCTAATAAGGATGTAATTTTCGCATCTATTTTAACTGCTCTTTTTTGTGTCTATTTGCACTTGTTTATCAGATTTGTCTTATTTTCAAATAAGTA
ATCTTCGTAGAAAATGGATTCTTTGTTAGGTTCTAGCGAAAGCAAAGGTTAAGGTTGACGAGATACAACCAGGTAAATTACTATTTGAACTGTGTGCACCAAAGAAACGTGTTCTGTTAT
GCGCCTTTGTGCTAATTTCACATTTTATGTGATCTCAGTGTCTTGGGCGGATATGATCTCTGTCGCTGGGTCTGAAGCAGTTTCAATATGTGGCGGCCCAACAATTCCAGTAGTTTTGGG
AAGACTTGATTCAGC
GTAAGCACAACATAAACGGTTTTTAATCCTATTGGATAGATCTCTGGTCACTGTTTCTATACTTTTAACAGGGTGATTGTTTCATGTTCACAGGCAACCTGATCC
AGAAGGCAAGCTACCTCCAGAAACCCTGAGTGCCTCGGGATTGAAAGAATGCTTCAAAAGAAAAGGATTTTC
GTGAGTCCTTAGCTGAGAATTGTTTCACAATGTATGTGTATGAGTAAC
TTAACATCACTGGGTTTGTGTGCCATTCCAGGACCCAGGAGCTTGTTGCCTTATCTGGGGCACATACGATTGGGAGTAAAGGCTTTGGAGATCCGACAGTTTTTGACAATGCATACTACA
AAATCCTTCTTGAAAAACCATGGACGTCAACTT
GTAAGTCTCATAAGTCATAACAAGGTTCTTAAGTTCTTTTACTCATAGAGTTTCAGTTTTCTACCATTCCTCCCTATGTTCTGAAGA
TTGATTGTAAGACTGAGATTGTATATTTACTTAGTTTTCTTACAATGCTGTAGCTAAGATGACGAGCATGGTCGGGCTTCCTTCGGATCATGCTTTAGTGCAGGATGATGAGTGCTTAAG
GTTTCTCATCTACTCAAAGTTCTTACCTTATCATTTCATCACCTATTTTTCTCTCAAGTACCATTCAAAGTAGATGAACACTTAGAGAGTATAGGATCATTGGCAAGACTGTAAACTGTT
GATCACTGTTCTTGCCATTTGAGTAATCTGGATAACTATTCAACTGATATAGATTCGTGGTTTGATGATGCACAGGTGGGTGAAACGGTATGCAGAAGACCAAGACAAGTTCTTCGAAGA
CTTCACAAATGCTTATATCAAACTAGTAAATTCTGGGGCCAAATGGAATATGTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACTGCTTCTCTGGTTAAGACTTTTCTGTTTCGGTGCGACTCGTTTTCATCTTTCAAATTCAAATGCAAATTCGAATCTCCCGCGAAAACGCGATTGCTCTCTCCGGCG
ACCGAGAAACATGTTGTCAGATCGTCAAGAGCCTGGCGTATTCGTTGCTTATCCGATGATCCTG
GTTCGAGTCATGTTTTCGTTGCAAGTAGAAGGAAAATGGTAGTCTTGTTGTCGACG
GTGCAGCTTCTGTCTCATATGCTTCCGCAAAACGGGAACGCAGCTGA
GATTTATCCGGTGATGCAAAACGAAATAAGGAAAGTGGTGACAAAGGGCAAGGCTGCTGGTGTGCTTCGTTTA
GTGTTTCATGATGCTGGAACCTTTGAACTGGACGATCATTCTG
GTGGCATCAACGGATCTATTGCTTATGAACTTGAGAGACCTGAGAACATAGGTTTGAAGAAATCCTTAAAGGTTCTA
GCGAAAGCAAAGGTTAAGGTTGACGAGATACAACCAG
TGTCTTGGGCGGATATGATCTCTGTCGCTGGGTCTGAAGCAGTTTCAATATGTGGCGGCCCAACAATTCCAGTAGTTTTGGGA
AGACTTGATTCAGC
GCAACCTGATCCAGAAGGCAAGCTACCTCCAGAAACCCTGAGTGCCTCGGGATTGAAAGAATGCTTCAAAAGAAAAGGATTTTCGACCCAGGAGCTTGTTGCCTTA
TCTGGGGCACATACGATTGGGAGTAAAGGCTTTGGAGATCCGACAGTTTTTGACAATGCATACTACAAAATCCTTCTTGAAAAACCATGGACGTCAACTT
CTAAGATGACGAGCATGGTC
GGGCTTCCTTCGGATCATGCTTTAGTGCAGGATGATGAGTGCTTAAG
GTGGGTGAAACGGTATGCAGAAGACCAAGACAAGTTCTTCGAAGACTTCACAAATGCTTATATCAAACTAGTA
AATTCTGGGGCCAAATGGAATATGTTATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCCCGGTTC ATAAATTTGA GCTAGGGTCT CGGAGACTCT CGTCCCACCG TTAAAGATGA CGACGACGAC TGCTTCTCTG GTTAAGACTT TTCTGTTTCG GTGCGACTCG TTTTCATCTT  TCAAATTCAA ATGCAAATTC GAATCTCCCG CGAAAACGCG ATTGCTCTCT CCGGCGACCG AGAAACATGT TGTCAGATCG TCAAGAGCCT GGCGTATTCG TTGCTTATCC GATGATCCTG  GTTCGAGTCA TGTTTTCGTT GCAAGTAGAA GGAAAATGGT AGTCTTGTTG TCGACGGTGC AGCTTCTGTC TCATATGCTT CCGCAAAACG GGAACGCAGC TGAGATTTAT CCGGTGATGC  AAAACGAAAT AAGGAAAGTG GTGACAAAGG GCAAGGCTGC TGGTGTGCTT CGTTTAGTGT TTCATGATGC TGGAACCTTT GAACTGGACG ATCATTCTGG TGGCATCAAC GGATCTATTG  CTTATGAACT TGAGAGACCT GAGAACATAG GTTTGAAGAA ATCCTTAAAG GTTCTAGCGA AAGCAAAGGT TAAGGTTGAC GAGATACAAC CAGTGTCTTG GGCGGATATG ATCTCTGTCG  CTGGGTCTGA AGCAGTTTCA ATATGTGGCG GCCCAACAAT TCCAGTAGTT TTGGGAAGAC TTGATTCAGC GCAACCTGAT CCAGAAGGCA AGCTACCTCC AGAAACCCTG AGTGCCTCGG  GATTGAAAGA ATGCTTCAAA AGAAAAGGAT TTTCGACCCA GGAGCTTGTT GCCTTATCTG GGGCACATAC GATTGGGAGT AAAGGCTTTG GAGATCCGAC AGTTTTTGAC AATGCATACT  ACAAAATCCT TCTTGAAAAA CCATGGACGT CAACTTCTAA GATGACGAGC ATGGTCGGGC TTCCTTCGGA TCATGCTTTA GTGCAGGATG ATGAGTGCTT AAGGTGGGTG AAACGGTATG  CAGAAGACCA AGACAAGTTC TTCGAAGACT TCACAAATGC TTATATCAAA CTAGTAAATT CTGGGGCCAA ATGGAATATG TTATGATATC TAATCTAGTT TTATATTTTG TTAGCTCATA  AGTGTTTCAA ACATGCCCGA ATAATTTGGG TAGTAATGCT TATTTGCTAA TAAGTAAAAA TTTCGCTGCT TACTAGTTTA CTACTACGAA ACTAAACATA AAAGATACTC AAACTTGACA 
CCAACTTACT TC 

Retrieve as FASTA