Entry information : MtPrx71 (Medtr2g028980.1[4.0] / Medtr2g028980.1[3.5] / Medtr2g034550.1[3.0])
Entry ID 396
Creation 2008-10-08 (Christophe Dunand)
Last sequence changes 2010-09-15 (Haythem Mhadhbi)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtPrx71 (Medtr2g028980.1[4.0] / Medtr2g028980.1[3.5] / Medtr2g034550.1[3.0])
Name (synonym) MtPrx71 (Medtr2g028980.1[4.0] / Medtr2g028980.1[3.5] / Medtr2g034550.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducer Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx71
start..stop
S start..stop
MtPrx17 577 0 1..355 1..355
MtPrx16 559 0 1..355 1..354
MtPrx12 538 0 1..355 1..352
MtPrx11 533 0 1..355 1..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10794288..10794509 222 N° 2 10793998..10794189 192 N° 3 10793708..10793873 166 N° 4 10793126..10793613 488
complement(join(10793126..10793613,10793708..10793873,10793998..10794189,1079428 8..10794509))


exon

Literature and cross-references MtPrx71 (Medtr2g028980.1[4.0] / Medtr2g028980.1[3.5] / Medtr2g034550.1[3.0])
Literature Journet,E.P. et al., unpublished.
DNA ref. Phytozome 11:   chr2 (10794509..10793126)
Cluster/Prediction ref. Phytozome Gene 11:   31067932
Omic ref. Gene atlas:   Mtr.31636.1.S1_at   Mtr.31637.1.S1_at
Protein sequence: MtPrx71 (Medtr2g028980.1[4.0] / Medtr2g028980.1[3.5] / Medtr2g034550.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (336)
PWM (Da):   %s   38759.77 (36673.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.35 (8.32) Peptide Signal:   %s   cut: 20 range:20-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSFRLIATFLCCIAVVFGVLPLCSNAQLDPAFYSKTCPNLNSIVREIVRNFTKIEPRMPAILIRLHFHDCFVQGCDASILLNNTATIVSELQALPNINSIRGLQVVNRIKTDVEKACPNTVSCADILALAARISSVLSKGPGWIVPLGRRDSLTANRTLANQNLPAPFFNLSQLKSSFAAQGLNTVDLVALSGAHTFGRARCSLFVDRLYNFSNTGEPDPTLDTTYLKQLQNECPQNGPGNNRVNFDPTTPDTLDKNFYNNLQVKKGLLQSDQELFSTPNADTTSIVNNFANNQSAFFESFKKAMIKMGNIGVLTGKKGEIRKQCNFVNKKSSELDLAALVSTESFDGDMVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 1 EST (AL373292).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCTTTCGTCTCATAGCAACTTTTTTGTGTTGTATTGCAGTTGTGTTTGGAGTGTTACCTTTATGTTCAAATGCACAGCTTGATCCAGCCTTTTATAGCAAAACTTGTCCAAAT
CTTAATTCCATTGTCCGCGAAATCGTTAGGAACTTTACTAAGATTGAGCCCCGAATGCCTGCGATTCTAATCAGGCTTCACTTTCATGATTGTTTCGTTCAA
GTAAGTATATATTATGAA
TTTAATTAGTATACTCTATCAGCTTACAATTATTAATTATGTAAACTGATGATGATATACATTATTAATTATTGAAACAGGGTTGCGATGCATCCATTTTGCTGAACAACACTGCTACTA
TCGTGAGCGAACTACAAGCTCTCCCAAATATCAACTCCATAAGAGGTTTGCAAGTTGTGAATCGTATCAAGACAGACGTGGAAAAAGCTTGCCCTAATACAGTTTCTTGTGCTGATATTC
TTGCACTTGCTGCTAGAATATCTTCCGTCCTG
GTACATATATGTCAAGCTAATTATTTTTAGTTTCAAGAAATTAGTTTTACATAAAATCATAATATTTGTGTTTACCTTTTAAAAAAAT
ATATGGTCTTAAAATAACATAAATCTATATTCACAGAGTAAAGGTCCCGGTTGGATCGTTCCATTGGGAAGAAGGGATAGTCTAACAGCAAATCGAACCCTCGCAAATCAAAATCTTCCA
GCCCCTTTCTTCAATCTAAGTCAACTTAAATCTTCCTTTGCTGCTCAAGGTCTCAACACGGTTGATCTAGTAGCACTCTCAG
GTATATATATGACATGAGGTTTTGAAGTTTTCACCTAA
AAATATTACATTTGATGGAAGAGTATATGATTTACTTATATGCTTGAATATTCCAGGTGCACACACATTTGGGAGAGCACGTTGTTCTTTATTCGTTGATCGATTATACAACTTCAGCAA
TACTGGCGAACCTGATCCAACTCTTGATACAACGTACTTAAAACAATTGCAAAACGAATGTCCTCAAAATGGACCTGGAAATAACCGTGTAAATTTCGACCCAACTACTCCTGATACATT
GGACAAGAACTTCTACAACAATCTTCAGGTTAAAAAGGGTTTGCTTCAAAGTGACCAAGAATTGTTTTCAACACCAAATGCAGATACCACTAGCATTGTTAATAACTTTGCCAATAACCA
AAGTGCTTTCTTTGAGAGCTTTAAGAAAGCAATGATTAAAATGGGTAATATTGGTGTGCTTACCGGAAAGAAAGGAGAAATAAGGAAACAATGCAATTTTGTTAACAAAAAATCTTCTGA
GTTAGATCTTGCCGCTCTGGTCTCCACAGAATCATTTGATGGGGATATGGTTAGTTCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCTTTCGTCTCATAGCAACTTTTTTGTGTTGTATTGCAGTTGTGTTTGGAGTGTTACCTTTATGTTCAAATGCACAGCTTGATCCAGCCTTTTATAGCAAAACTTGTCCAAAT
CTTAATTCCATTGTCCGCGAAATCGTTAGGAACTTTACTAAGATTGAGCCCCGAATGCCTGCGATTCTAATCAGGCTTCACTTTCATGATTGTTTCGTTCAA
GGTTGCGATGCATCCATT
TTGCTGAACAACACTGCTACTATCGTGAGCGAACTACAAGCTCTCCCAAATATCAACTCCATAAGAGGTTTGCAAGTTGTGAATCGTATCAAGACAGACGTGGAAAAAGCTTGCCCTAAT
ACAGTTTCTTGTGCTGATATTCTTGCACTTGCTGCTAGAATATCTTCCGTCCTG
AGTAAAGGTCCCGGTTGGATCGTTCCATTGGGAAGAAGGGATAGTCTAACAGCAAATCGAACCCTC
GCAAATCAAAATCTTCCAGCCCCTTTCTTCAATCTAAGTCAACTTAAATCTTCCTTTGCTGCTCAAGGTCTCAACACGGTTGATCTAGTAGCACTCTCAG
GTGCACACACATTTGGGAGA
GCACGTTGTTCTTTATTCGTTGATCGATTATACAACTTCAGCAATACTGGCGAACCTGATCCAACTCTTGATACAACGTACTTAAAACAATTGCAAAACGAATGTCCTCAAAATGGACCT
GGAAATAACCGTGTAAATTTCGACCCAACTACTCCTGATACATTGGACAAGAACTTCTACAACAATCTTCAGGTTAAAAAGGGTTTGCTTCAAAGTGACCAAGAATTGTTTTCAACACCA
AATGCAGATACCACTAGCATTGTTAATAACTTTGCCAATAACCAAAGTGCTTTCTTTGAGAGCTTTAAGAAAGCAATGATTAAAATGGGTAATATTGGTGTGCTTACCGGAAAGAAAGGA
GAAATAAGGAAACAATGCAATTTTGTTAACAAAAAATCTTCTGAGTTAGATCTTGCCGCTCTGGTCTCCACAGAATCATTTGATGGGGATATGGTTAGTTCAATTTAA

Retrieve as FASTA