Entry information : OsAPx-R
Entry ID 3961
Creation 2007-04-13 (Christophe Dunand)
Last sequence changes 2010-08-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-03 (Christophe Dunand)
Peroxidase information: OsAPx-R
Name OsAPx-R
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Chloroplastic
Tissue types Leaves
Stems
Whole plant
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx-R
start..stop
S start..stop
OsiAPx-R 676 0 1..331 1..331
ObrAPx-R 609 0 1..331 1..331
TaAPx-Ra 520 0 1..331 1..333
BdiAPx-R 514 0 1..331 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25967566..25967639 74 N° 2 25967357..25967472 116 N° 3 25967168..25967258 91 N° 4 25966751..25966878 128
N° 5 25966490..25966560 71 N° 6 25966330..25966372 43 N° 7 25966138..25966234 97 N° 8 25965868..25965951 84
N° 9 25965540..25965661 122 N° 10 25965297..25965363 67 N° 11 25964937..25965039 103  
complement(join(25964937..25965039,25965297..25965363,25965540..25965661,2596586 8..25965951,25966138..25966234,25966330..25966372,25966490..25966560,25966751..2 5966878,25967168..25967258,25967357..25967472,25967566..25967639))


exon

Literature and cross-references OsAPx-R
Literature Sasaki,T., Matsumoto,T. and Yamamoto,K. Oryza sativa nipponbare(GA3) genomic DNA, chromosome 8, BAC clone:OJ1081_B12. Published Only in Database (2001)
Protein ref. UniProtKB:   Q7F1J9
DNA ref. GenBank:   NC_008401.1 (25967639..25964940)
Cluster/Prediction ref. UniGene:   Os.17125
Protein sequence: OsAPx-R
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35454.89  
PI (pH):   %s   7.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTNVPHIAASSRFFSSCSRCTCRIRRSGKTRIGASAAGRRCSSDDSACSEPSEQQNADFFGPISSLCYTRRDFASVALLPFILPHVHIASAAEPIDGSIIQNGVRNVLSKVKAAGMLRLAFHDAGTFDIADKGGMNGSIIYEVDRPENTGLNKSIKVLGKAKEVIDLVQVSWADLIAVAGAESVALCGGPEIPVRLGRLDSSTADPAGKLPEETLDATALKTLFSKKGFSTQEMVVLSGAHTIGGKGFGNPNIFDNSYFKVLLEKPQPSSGMPAMVGLRTDWALTEDDECLRWINLYAQDQAKFFADFKDAYIKLVNTGASWRSA

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 8, 10 introns), 3 cDNA and 19 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACTAATGTCCCCCATATTGCAGCCTCCTCCCGCTTCTTCTCCAGCTGCAGTCGTTGCACCTGCAGGTAATGTTTGCATCTTCTCTCATGCTTTGATACCAACCGTGCCATC
ATTTGTTCATGGAAGGCACATGACCTGTGAAAATTGTGATGATACAGGATTAGAAGAAGTGGGAAGACGAGGATAGGAGCTTCTGCTGCTGGTCGTAGGTGCAGTAGTGATGATTCTGCT
TGTTCAGAACCCTCTGAGCAGCAAAATGCAGATTTCTTTTCAG
GTATGAGTTGTTTCCATTGCAAGAACTGAGAGAATGCTTCCAGTGCCTACTGATATATTTCTGCCCAACTGAATTTG
CTTTGTGTATGGTGACCACAGGTCCCATATCTTCTCTTTGTTATACAAGGAGGGACTTTGCTTCTGTTGCTCTGCTCCCTTTCATACTTCCTCATGTTCATATAGCGAGTGCGTAAGTGC
AGTATTCAACCATAATCATATTCCTATTCTGCTCTAAGTTTCCATAGCTATGAGTTGCTAACCGTATTAATTTACATTTCTATGAGTATTTTTATTTATGTTTAATTGGTTCAATTGTGG
AAGCATGGCCTAGAATCAAAAGTCGAAATGAACCACAGGTCAATAAAGTATACCTACAATAGCTATTTGTGTATAAGAATAACCTACTCAAAGTAGTTTCATTCTCGTAAAACGGCAGTA
TGACATCTTTTAGAGAAGTTTTTTTATGTTTGACTCTATAGGGCTGAGCCAATTGATGGTTCAATTATTCAAAACGGTGTGAGGAATGTTTTATCCAAGGTCAAGGCTGCTGGCATGCTT
CGTTTGGCTTTCCATGATGCAGGGACTTTTGATATTGCTGATAAATCAG
GTTCGATCTTTAATGTCTTCATTGGTTGAAGTTCTATATACAGTTTTAGAGCAAAAATTGAATGTGTATAA
AGTAGAATTATAGAGTATTGCAAACAAGAACAAACTACGAATAACTACACTTCAACCTATCTAAAGATGAATTCTGAGAAGTAAAACAGTAGATGGATATTTATGACAATATCTTGCAGG
TGGCATGAATGGATCTATAATTTATGAAGTTGATAGACCTGAAAATACTGGGCTAAATAAATCCATAAAG
GTTTTTTTCCTCCTTTTTTTTCTTGCTTTTTATCATAAATAGTAGTAACA
TATCCTTACTGAAGAACAACATGTTTTGACTTCCCATATCTGTTTTTAATGACTTATAACTGAACAGGTATTAGGAAAAGCGAAAGAAGTAATTGACCTTGTGCAGCAAGGTACATGGTT
TACACCCTTTTTATATGTTCTTTCTGTTTTGAGCTTCGGTTGTGATGTATCTTCAAGCACACATATACCGTTACTTTGCTAACAGTATCATGGGCGGATTTGATTGCCGTGGCTGGTGCT
GAGTCAGTTGCGCTATGTGGAGGGCCAGAAATTCCAGTAAGACTAGGTCGATTAGATTCCAG
GTGCAACATCACAGTGGTTTGTTCATTTAACAGTTCCCTTGCAATGTTGGCAAAATTT
TAGGCTGTTCATTTCCAGGCAGTGCTTCTATTTAGTATGCATCCATATTTTTTAAAGAACATGTAGGTATCCATATTTTCTCAAAGTAATACCCATATTCTTATGAAATAATGCATTTGA
CTCTGTAGTACTGCTGATCCTGCTGGTAAACTTCCTGAAGAAACATTGGATGCCACTGCGCTGAAAACATTATTCAGCAAAAAGGGCTTTTCGTGAGTCCTCCTTTTCTCTACTTACACA
AACATCTTGTGAATTCAATTCCCATTGCCTATTTATGAAAATTTACTAATGCGTGGTTAAAAATTATGTATCTGTACATGATACGTATCTGCACATGATTTCCCCTCTAGGCTTCTACAA
AATGTTCCTCAAAACTTAGCATCCTTCCATGTCTGAAGTTAAACTTGATACTTGGCAGGACACAGGAGATGGTTGTGTTATCTGGAGCACACACAATTGGAGGTAAAGGATTCGGGAATC
CAAATATTTTCGACAACTCCTATTTTAAAGTACTCCTTGAGAAGCCACAGCCATCTTCAT
GTAAGTCCATTCATTTTTTCCATCATGCCCTTTAAATACTGTCATCATGAATCCATAAGC
CATAACTGAATCTCAACTTAGCTCATGCCTTTGTAAATCATCCTTGTACAATGTACAATCGACTTGGCATTATTTGTAAATCACCTTAATACAATGTGTTGTGTTCTTCTATGAAGCTGG
CATGCCGGCAATGGTAGGACTGCGAACGGATTGGGCACTCACTGAAGATGATGAATGCTTAAG
GTATTTTTTTTCTTGAACTAGATATGCTAAATAATGTCGCTTACTTGTTACAAGCTC
TGAAGAAGTACTAGGGATAATCATAAGCTTCCAAACTCCATGCACTAATCCTACTCTATCTTCAATTCTTTCAGTCAGGACCTAGGCTTTAGGTTTTAAGTCACAAATTTATAGGACAAA
TAGATATATTTGCAAGGTTCCTTCATGCTCACATGTTTGGTCAGGCCATTGACATTGGGCATATGCCAAACTACTTGCAGATGGATCAATTTATATGCACAGGACCAAGCTAAATTTTTT
GCCGACTTCAAGGATGCATACATCAAGCTTGTAAATACTGGAGCCTCATGGAGATCAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACTAATGTCCCCCATATTGCAGCCTCCTCCCGCTTCTTCTCCAGCTGCAGTCGTTGCACCTGCAGGATTAGAAGAAGTGGGAAGACGAGGATAGGAGCTTCTGCTGCTGGT
CGTAGGTGCAGTAGTGATGATTCTGCTTGTTCAGAACCCTCTGAGCAGCAAAATGCAGATTTCTTTTCAG
GTCCCATATCTTCTCTTTGTTATACAAGGAGGGACTTTGCTTCTGTTGCT
CTGCTCCCTTTCATACTTCCTCATGTTCATATAGCGAGTGC
GGCTGAGCCAATTGATGGTTCAATTATTCAAAACGGTGTGAGGAATGTTTTATCCAAGGTCAAGGCTGCTGGCATGCTT
CGTTTGGCTTTCCATGATGCAGGGACTTTTGATATTGCTGATAAATCAG
GTGGCATGAATGGATCTATAATTTATGAAGTTGATAGACCTGAAAATACTGGGCTAAATAAATCCATAAAG
GTATTAGGAAAAGCGAAAGAAGTAATTGACCTTGTGCAGCAAGTATCATGGGCGGATTTGATTGCCGTGGCTGGTGCTGAGTCAGTTGCGCTATGTGGAGGGCCAGAAATTCCAGTAAGA
CTAGGTCGATTAGATTCCAG
TACTGCTGATCCTGCTGGTAAACTTCCTGAAGAAACATTGGATGCCACTGCGCTGAAAACATTATTCAGCAAAAAGGGCTTTTCGACACAGGAGATGGTT
GTGTTATCTGGAGCACACACAATTGGAGGTAAAGGATTCGGGAATCCAAATATTTTCGACAACTCCTATTTTAAAGTACTCCTTGAGAAGCCACAGCCATCTTCAT
CTGGCATGCCGGCA
ATGGTAGGACTGCGAACGGATTGGGCACTCACTGAAGATGATGAATGCTTAAG
ATGGATCAATTTATATGCACAGGACCAAGCTAAATTTTTTGCCGACTTCAAGGATGCATACATCAAG
CTTGTAAATACTGGAGCCTCATGGAGATCAGCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTCCACAAGG ACGGGAATGG AGCTCACTAA TGTCCCCCAT ATTGCAGCCT CCTCCCGCTT CTTCTCCAGC TGCAGTCGTT GCACCTGCAG GATTAGAAGA AGTGGGAAGA CGAGGATAGG  AGCTTCTGCT GCTGGTCGTA GGTGCAGTAG TGATGATTCT GCTTGTTCAG AACCCTCTGA GCAGCAAAAT GCAGATTTCT TTTCAGGTCC CATATCTTCT CTTTGTTATA CAAGGAGGGA  CTTTGCTTCT GTTGCTCTGC TCCCTTTCAT ACTTCCTCAT GTTCATATAG CGAGTGCGGC TGAGCCAATT GATGGTTCAA TTATTCAAAA CGGTGTGAGG AATGTTTTAT CCAAGGTCAA  GGCTGCTGGC ATGCTTCGTT TGGCTTTCCA TGATGCAGGG ACTTTTGATA TTGCTGATAA ATCAGGTGGC ATGAATGGAT CTATAATTTA TGAAGTTGAT AGACCTGAAA ATACTGGGCT  AAATAAATCC ATAAAGGTAT TAGGAAAAGC GAAAGAAGTA ATTGACCTTG TGCAGCAAGT ATCATGGGCG GATTTGATTG CCGTGGCTGG TGCTGAGTCA GTTGCGCTAT GTGGAGGGCC  AGAAATTCCA GTAAGACTAG GTCGATTAGA TTCCAGTACT GCTGATCCTG CTGGTAAACT TCCTGAAGAA ACATTGGATG CCACTGCGCT GAAAACATTA TTCAGCAAAA AGGGCTTTTC  GACACAGGAG ATGGTTGTGT TATCTGGAGC ACACACAATT GGAGGTAAAG GATTCGGGAA TCCAAATATT TTCGACAACT CCTATTTTAA AGTACTCCTT GAGAAGCCAC AGCCATCTTC  ATCTGGCATG CCGGCAATGG TAGGACTGCG AACGGATTGG GCACTCACTG AAGATGATGA ATGCTTAAGA TGGATCAATT TATATGCACA GGACCAAGCT AAATTTTTTG CCGACTTCAA  GGATGCATAC ATCAAGCTTG TAAATACTGG AGCCTCATGG AGATCAGCTT AATTTTACTC GCACACAGCT CTCTCTCGTG TAGGCTATTA GGCACGATTC AAACGTAGGA ACCTCAGAGA  ATTTTTGTGG AAAACAAAGC AATGGAGGTC TGGATTTCTT AATATTTACT CCAAAGACAA GCTTTCACCG TAAATTTCTT ACTGTTACGA AATCATAGTC ATTAAATAGG AGTTTCGAAC  ATGAATCCAA CAAATATATT TTTGTATAGC AAAACCTATA TATTATTTTA TTACCAAGGG TCAAAGCATA GAACTAGACA ATCAAAATCC TCCTTATATT TTTGAATGTA GGGGGCTAAT 
AAATCATGCA GTTCTGTAGG ATATATTTTC AACAAACATC AATAAGGAAT GTAAGAATTG GAACTTTCAT GTTAAAGGCA GCGTTCTTTT CTGAAACTTC AAACGTC 

Retrieve as FASTA