Entry information : OsAPx10
Entry ID 3966
Creation 2006-09-22 (Filippo Passardi)
Last sequence changes 2006-09-22 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsAPx10
Name OsAPx10
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Flowers
Leaves
Roots
Stems
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx10
start..stop
S start..stop
SbAPx09 572 0 1..348 1..351
ZmAPx10 566 0 1..348 1..351
SiAPx04 561 0 1..348 1..353
BdiAPx08 542 0 1..348 11..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30419673..30419789 117 N° 2 30419882..30419977 96 N° 3 30420180..30420264 85 N° 4 30420352..30420386 35
N° 5 30420479..30420544 66 N° 6 30420646..30420686 41 N° 7 30420818..30420933 116 N° 8 30421101..30421207 107
N° 9 30421354..30421491 138 N° 10 30421610..30421744 135 N° 11 30421888..30421998 111  
join(30419673..30419789,30419882..30419977,30420180..30420264,30420352..30420386 ,30420479..30420544,30420646..30420686,30420818..30420933,30421101..30421207,304 21354..30421491,30421610..30421744,30421888..30421998)


exon

Literature and cross-references OsAPx10
Literature Feng, Q. et al.

Sequence and analysis of rice chromosome 4

Nature 420 (6913), 316-320 (2002)
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=CAE01822.2
Protein ref. UniProtKB:   Q7XSS2
DNA ref. GenBank:   NC_008397.1 (30419673..30421995)
Protein sequence: OsAPx10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348
PWM (Da):   %s   37557.49  
PI (pH):   %s   8.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGASFLSTVRQPPAPPPPLLAPRGSASSVSSPARRHAHILVCCHATAQEEPVRFRRRDLIGGCLTTAIGLELVEGSTGFTGVATAADLIERRQRSEFQSSIKSTLATAIAKKELIPSLLTLALNDAMTYDKATKSGGPNGSVRLRPENSGLSAAVDLLVEAKKEIDSYSKGGPIAFADLIQFAQSALKLTFVDAAIAKCGGNEEKGRTLYSAYGSNGQWGLFDKLFGRQDTQEPDPEGRVPDWSKASVQEMKDKFVAVGLGPRLAVMSVFLGPDQAATEERLIADKDCRPWVEKYQRSRETVSRTDYEVDLITTLTKLSSLGQKINYEAYTYPKQKIDLGKLKL*

Retrieve as FASTA  
Remarks genomic DNA. Chromosome 4. 2 mRNA sequences. 48 EST sequences. UniGene Os.17232.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGCGCGAGCTTCCTCTCGACCGTGCGGCAGCCTCCCGCGCCGCCGCCGCCGCTGCTCGCCCCACGCGGCTCCGCTTCCTCCGTCTCGTCTCCCGCGCGACGGCACGCCCACGTA
TGTGCCCTGGAACTCGCGGGTGTAGTTTTGGTTTGGGCTAAAAATGCCGTGTGATTTGTGTAATCCTTGGGATTTTTTTTTCCGTGTAGATTCTGGTGTGCTGCCATGCTACCGCGCAGG
AAGAGCCTGTGCGATTCCGTAGAAGGGATTTAATCGGCGGCTGCTTGACTACTGCCATTGGCTTG
GTGCGTACCACTATTCTTCGTCCCTTTTGTTTGCGTGATCAGTGTAGTGTAGTCT
TCTTATACTTTATTGGAGTAAGAAAGTGAATGAAATGTAGTATGGTGGGGGTAAAGAATATTAACCTGCAGTTAGTGCTTTTCCTTTTCCATGTTTAGTGTTGTTTTCAGAGGCGATAGG
CTTAACTACTTCATGTCTTTTGATTAGGAATTAGTCGAGGGCTCTACAGGATTCACAGGAGTGGCTACTGCAGCTGATCTGATTGAGCGTCGACAACGCTCTGAATTCCAATGTAGGTCA
CCTCTGGCCGTTCCTTTTCCTTTGAATGCTATGTGCTTCTTTCCATGATAGTAATTCTTGCTTCCGTTTCTTTCTTCAGCAAGCATCAAAAGCACCCTCGCCACAGCCATAACGGTGAGA
TTGTATATTTTTTGCACTTCCTTAAGTCATTTTTACTTTGACCTATCTATCGATTTTTCCGGCTGAAATTTGATAACCCTTTGAAGGCTAAAAAAGAGCTCATTCCATCTTTGTTGACGT
TGGCACTGAATGATGCCATGACATATGATAAG
GTATGGTCTGGCTTCCTGAATTTACCGGCTGAACCCTCTGTCCATACATGGCACGCTTGGAAATAACCTGTGAAAAACGGCTATCCAA
CACTCTTTTTTAGGCCACGAAGTCAGGAGGTCCAAATGGATCGGTCAGGCTAAGGTAGTAGCTTCTGTTGGTACATATTTGTGTTGACGTTGCAAATATGCTCTTCAGATGAAAATCTAA
CAAGTTGCTCGGCCTCGTCATTCCTTCCTTTTCACCATTAAATAATAAAGTGCAGAAATAAGCAGACCTGAAAACAGTGGACTTTCTGCTGCTGTGGATCTGCTAGTTGAAGCGAAAAAG
GAGATAGATTCCTACTCCAAGGGAGGACCCATTGCATTTGCAGATCTGATCCAATTTGCAG
GTGTGACATACTTTGGACATAATTTTACTAGCACTTGTGTAATATTACCAAACTGGCTC
TATTTTACCTTTGTTATTGTCAAGACCTCTTTTACAATAGTTGGAAAGGTACCAAGAAGTAATGGACATAGTAATAAACACCTCAAAATTTGCTTTCAATTGCAACAGCACAATCAGCAC
TCAAGCTAACATTCGTTGATGCGGCCATTGCCAAATGTGGCGGGAACGAAGAAAAAGGAAGAACACTATACTCAGCTTATGGTTCAAATGGCCAG
GTATTCCCTATACCATGTCACTCCG
TGTGTCAAATAACACTACACTATATGTTAAGTTTCTTCTGTCTGTCTGTATGGGCTTAGCTTACTAATTCAAGGTGCCATATATTTTTATGTTGATGCTTTGTTTGCATTTACCGCTGCA
GTGGGGTTTATTCGACAAACTGTTCGGGCGACAAGATACACAGGAACCTGATCCTGAAGGAAGGGTACCTGACTGGAGCAAAGCTTCTGTGCAGGAAATGAAGGATAAGTTCGTCGCAGT
TGGTTTGGGTCCTCGTCAG
GTCACTAGCTACTGTCTTACATCGCTTAGCAAATTGTGTTACTGATCAATCATTTAATCTATAAGAAACTGTGATCCAGCAAACTTGTCTTTAAATATGAG
ATGATTTTGCATTTCAGCTTGCTGTGATGTCAGTCTTCCTGGGGCCTGACCAAGCTGCCACGGAGGAACGGTTGATAGCCGACAAGGATTGCCGCCCATGGGTCGAGAAGTATCAACGCA
GTCGCGAGACGGTCTCTCGAACTGACTACGAG
GTAAGATCATCTACCTCCGTCCCAAAACATCCGGATATATTGCTAAAAGTTGCTATATTCAAGATGGAGATTGTAACCATTCGTGCTG
CAGGGTAACTCAGAACTCTTGTAGTGTTGATGCTGACATGTGTTTTGTATGTCAGGTTGACCTGATAACCACGCTCACAAAGCTGAGCTCCCTTGGGCAGAAGATAAACTACGAGGCCTA
CACGTACCCTAAGCAAAAGATTGACTTGGGTAAATTGAAATTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGCGCGAGCTTCCTCTCGACCGTGCGGCAGCCTCCCGCGCCGCCGCCGCCGCTGCTCGCCCCACGCGGCTCCGCTTCCTCCGTCTCGTCTCCCGCGCGACGGCACGCCCACATT
CTGGTGTGCTGCCATGCTACCGCGCAGGAAGAGCCTGTGCGATTCCGTAGAAGGGATTTAATCGGCGGCTGCTTGACTACTGCCATTGGCTTG
GAATTAGTCGAGGGCTCTACAGGATTC
ACAGGAGTGGCTACTGCAGCTGATCTGATTGAGCGTCGACAACGCTCTGAATTCCAAT
CAAGCATCAAAAGCACCCTCGCCACAGCCATAACGGCTAAAAAAGAGCTCATTCCATCTTTG
TTGACGTTGGCACTGAATGATGCCATGACATATGATAAG
GCCACGAAGTCAGGAGGTCCAAATGGATCGGTCAGGCTAAGACCTGAAAACAGTGGACTTTCTGCTGCTGTGGATCTGCTA
GTTGAAGCGAAAAAGGAGATAGATTCCTACTCCAAGGGAGGACCCATTGCATTTGCAGATCTGATCCAATTTGCAG
CACAATCAGCACTCAAGCTAACATTCGTTGATGCGGCCATTGCC
AAATGTGGCGGGAACGAAGAAAAAGGAAGAACACTATACTCAGCTTATGGTTCAAATGGCCAG
TGGGGTTTATTCGACAAACTGTTCGGGCGACAAGATACACAGGAACCTGATCCTGAA
GGAAGGGTACCTGACTGGAGCAAAGCTTCTGTGCAGGAAATGAAGGATAAGTTCGTCGCAGTTGGTTTGGGTCCTCGTCAG
CTTGCTGTGATGTCAGTCTTCCTGGGGCCTGACCAAGCT
GCCACGGAGGAACGGTTGATAGCCGACAAGGATTGCCGCCCATGGGTCGAGAAGTATCAACGCAGTCGCGAGACGGTCTCTCGAACTGACTACGAG
GTTGACCTGATAACCACGCTCACA
AAGCTGAGCTCCCTTGGGCAGAAGATAAACTACGAGGCCTACACGTACCCTAAGCAAAAGATTGACTTGGGTAAATTGAAATTGTGA

Retrieve as FASTA