Entry information : OsAPx11
Entry ID 3967
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2008-09-02 (Christophe Dunand)
Sequence status complete
Reviewer Michele Oliva
Last annotation changes 2010-08-03 (Christophe Dunand)
Peroxidase information: OsAPx11
Name OsAPx11
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsAPx11
start..stop
S start..stop
ZmAPx04 498 0 1..289 1..289
SbAPx04 497 3e-180 1..289 1..289
ScAPx04 484 4e-175 1..289 1..291
TaAPx06 481 3e-174 1..289 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20903488..20903600 113 N° 2 20901688..20901812 125 N° 3 20901257..20901306 50 N° 4 20900349..20900414 66
N° 5 20900219..20900267 49 N° 6 20899740..20899799 60 N° 7 20899113..20899135 23 N° 8 20898953..20899032 80
N° 9 20898762..20898864 103 N° 10 20898480..20898680 201  
complement(join(20898480..20898680,20898762..20898864,20898953..20899032,2089911 3..20899135,20899740..20899799,20900219..20900267,20900349..20900414,20901257..2 0901306,20901688..20901812,20903488..20903600))


exon

Literature and cross-references OsAPx11
Literature Sasaki,T., Matsumoto,T. and Katayose,Y.Oryza sativa nipponbare(GA3) genomic DNA, chromosome 9, PAC clone:P0229B10 Published Only in Database (2003)
Protein ref. UniProtKB:   A2Z3J3 [Incorrect splicing]   Q69JE6 [Incorrect splicing] UniProtKB_Uniparc:   A3C114 [Incorrect splicing]
DNA ref. GenBank:   NC_008402.1 (20903600..20898483)
Cluster/Prediction ref. UniGene:   Os.55638 [3' end]
Protein sequence: OsAPx11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31445.17 Transmb domain:   %s   o260-282i
PI (pH):   %s   7.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPVVDAEYLRQVEGARRDLRALIASKGCAPIMLRLAWHDAGTYDAKTKTRGANGSIRHEEEYTHGSNAGLKIAIDLEPIKRKHPNITYADLYLAGVVAVEVTGGPTVDFVPGRRDSSVCPREGRLPDAKKGAPHLRDIFYQMGLTDKDIVALSGGHTGKAHPERSGFDGAWTKEPLKFDNSYFLELLREESEGLLKLPTDRALLEDPEFRRFVDHYADEDAFFKDYAESHKKLSELGFAPRSSAKSDGSTAAATLAQSAFGVAVAAAVVVIAGYLYESSKKTK*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (chromo 9, 9 introns), 1 mRNA and 3 ESTs. Extra intron just before VALSGGHT (=> short exon). sequencing error or pseudogene?
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCGGTGGTGGACGCGGAGTACCTGCGACAGGTCGAGGGGGCGCGCCGCGACCTCCGCGCGCTCATCGCCTCCAAGGGCTGCGCCCCCATCATGCTCCGCCTCGCGTCCGTA
ACCGATCCTCACACCCCTCTCTCTCGCTGTGCTTTTTTGATTCGGTCGATTTACTCGTGCGGGGGTTTATACTGATCGATCGATCGAGTGTCGGATCGAGCTGGACGAGCAGTTGTTCTT
CAGTGCTTGCCTGCTTTGGGTGTTTGTAGCTAGGGGGTTAATTCGTCGGTGACTGCGTGCTAGCCATAATTATCTTTACAGCTCGGGGATTCTGAAGTTATCATAGGAAGTGCAGAGTGC
TCGCTCTCCAAGCCATCACTGATTCACGGTACTGTTGGTTGCTAGCTGCAAGGTTGTTGCACGGCCACACAAGTTTGCTAGCAATTGAAATGCCTTCCTGGATCCCAGGAGGGCCACCAC
ATCCTAGTATGAGGAAAGGCTTAATTTTCTTGGGGGAATGGAATTTGGGGGAGAATGGTGACATACTGACATATTCTCAATCGGCAGGCAGGTTATATATGTGAATGTAATGTAGCCCCA
TTTTCTAGCAACAGCACAGAAGTAAGTACTTTGAGAATCTACGAACTCACGCTGAATATCATATACTCCCTCCGTTTTTTAATAGATGACGCCGTTGACTTTTTCTCACATGTTTGACCA
TTCGTCTTATTCAAAAAATTTATGCAAATGCATAAGATATAAATCATACTTAAAGTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGA
CGAATGGTCAAACATGTGAGAAAAAGTCAACGGCGTCATCTATTAAAAAACGGAGGTAGTAATAGTCTTGAGATGGTCGTCCATACACCTTTTGGAGCTAGGGCCACGTTTTCATAGTAA
AAAAGAATGGTGGTCCAAAGGCTTGATCAGGATGGTTTCTGTGGACTGACCGTGTAATCTGTCACTGGGGCAAGCGGAATCCTACAATCGGATTTGGAGGAGGATTAGGCTCTGCATTTC
TACCGTCAAATGGCACTTGATTCCTTTGTGTCTCACTTCCTTACCTCTTTCTCTTTTTCTTGCTTCCATCCATGAATCTTGTTTCATTCTTCCTCCAAAAGAACTGAACTCTGCATCGTC
ATAGTCATATTATGTAATTGGAGGAGTTTTTAGTTTTTACCTTTGCGAGAATAAAGCTTCTATATTTCTTACCTTTGAGGCCTCATATATATTTACATATTTTGTTTGAACCTTGCGATC
CTTCTCTATTAATGAAATAGGCAACACTCCTGCTTATATTTCAAAAGAAAAAAAAGAATCCGTGCCTTTCTCACCGGGGATTGGATGCTAGTATCTTAGTCTGATACGAGTATATGCATA
CTTGGAATTGGAGGGTCAAGGGCAGCATGTTGTCCCTTTTGGACACTTAGTACCAAAATTTTATATTCATTACAGCACCAGAACAAGTTGTTTCGCCATCTTTGTGATAATTGATACTAG
TGTTTTTGGCGACACATACCTTGTTATGCACTTATGTCCACATGCCAAAGTAGTAACTAGTAAGGGCAACCCCCCCAAAAATAAAAATCTTTAGTAGTATGATTTTGGCTTCTCAGTCAG
TCATTTGGTGTGTGTTCCTCCATGAAGCTTCCATGTTTATCTTCCTTGTTAGATAGTTACTTTGCCATTCTCTTTTTCATGTGGAGACTTTATCTTCTGTACTTGCAGATGGCATGATGC
TGGCACATATGATGCAAAAACAAAAACTAGGGGTGCAAATGGTTCAATTAGGCATGAGGAAGAGTACACTCATGGTTCAAATGCTGGACTAAAAATTGCCATTGATCTCCTTG
GTGTGTA
CTTTGCAATATCATTGACCTTGTAGCTACATAATTTTCTACTTGTTTGTCCTTGTGTAGGCAATCCTCACTTGTTGCCGATCATTTTAAGAAGATTAATTGATGTGTTACTGATCTTGTT
CCTTCTCTTGTAGTAGCCTAGTAGCTTTGAAACTTGATTACGGTGGTCTCTTCCCTCTTCACTTTTATCACCGGAAGCTTTTGCTTCTGTTTACTACTTGACCTTGGAAAATTGTAACAC
CATTCTGATGACTTCATTGAGTAATTCGTTCTTCTGTACAGAACATTATTGGTTGCCAAGTCATTTTACTTCAATGGTTCTTTAATAAATTGTGTCATGATTACCACTTATCTGGTTGTC
TTATTTTCTGACAGAGCCTATTAAGCGAAAGCATCCAAATATCACTTATGCTGATCTTTATCAGGTACTCTGGATTCCTCCATTGTGTTTCTTGTTTCTATATAGCCTCAAGAGAGTAAT
AAAATTTCTGATATTGATTTTTTTTTGGCATGGTACTCCCTCTATTGATTTTACAAGTCATTTGACCTGACAATGTGTCCAGAGTTAAACATTGACCTACAAAATCATGATAGCACAGAA
GTACTTCTAATAAAAATATAAAATTTGTACTACTTAAACATATATAAATGTCGGAAAACTTTTGGCAAAATAAGGGATTATCTGCGGTTACATCATTGCTTTTGCATGATTCTTCATAGT
AGAATTGAAATGATATTTGAGTAAATTTCATAAAACTACATATACTTTGTATGATCTATCACAAAACTACAGATTTAAGAACTTATTTCACAAAACTACAGATTTAATATCTTCGTTTAT
CACAAAACTACAAGTATTATGCACAATATATCACAAAACTACAGATTTAAGAACTTGTTTCACAAAACTGCAGATTTAATATCTTCATTTATCACAAAACTACAGGTTTTAACCTGTAGT
TTTGTGATAATGGAGACACTAAATTTGTAGTTTTGTGATAAATGAAGACACTAAATCTGTAGTTCTATGATAAACGAATACACGAAATCTATAGTTTTGTGAAACAAGTTTTTAAATCTG
TAGTTTTGTGATAGATTGTACAAAGTACCTGTAGTTTTGTGATAAACGGACATACTAAATCTGTAGTTTTGTGAAACAAGCTCTTAAATATATAGTTTTGTGATAAATTATGCAAAATAC
CTGTAGTTCTGTGAAATTTACTCATGATATTTTGATGAACTAACCAGGATTATTTTTACTTCTCAGCTTGCTGGAGTGGTTGCAGTTGAAGTTACTGGAGGTCCAACCGTTGACTTTGTT
CCTGGAAGAAGG
GTAAATGAAATGTCATTTCCTTGTAGACGGATGCATTATCTTTGCCTTGTTCACTATGTAACTGATTTGTAATGTAATCAGGACTCATCAGTTTGCCCGCGAGAAGGA
CGTCTTCCTGATGCGAAGAAAG
GTTATTACTAAAGCCTTCTCATTATGCTGAATATAGATATATTCTTGTTGAGAACTTAGAATGAATTATCCACTAGAAGCATATGTCCTCTAGTTGAA
CTATTGCTGCATTGTTAATGATCAACATGTTACAGTAGCGGTTGCTTTGCATGAGCCATCCAATATACACATTTGTTCAGGAGTATTTCTTCTGAGCGCAAAAGAATATTCTTCAGGTTG
AATTCTTGGTTAACCGTCAGTGTATTGGCCTTTTCGCATGTCATATTGAGGCTACCACTTCTCAAATTTTATGGTTTACCTTTGCAGTAGGCTTTGTACAACTGTTGAACATCTACTATT
ATTCTATTTTGTCTGCTTAGGTCATATTCACCGAGGCCGCGAGGCATAAATTTTGATTACTCTTTCTTGTTTGCTGGTTAGGTGCACCACATTTAAGAGACATCTTTTATCAAATGGGAT
TGACTGACAAGGATATTGTAG
CTAGGGGTGAAAACGGTACGGAAACTTTCCGGATACCGGACCTATTTTCGAAAACGGAATTTGTCGGTCGGAATTTTTCGGAAACGGAAACAAATTCGG
AAATATTTTCCCGGAAACGGAATCGGAAATGATAAGGGCAGTTTCCGTCGGAACTCAGAATCGGTCGGAAACTTTCCAGAAATTTTCTTGGAATTACCAGAAATTTTGTGACTGAAATAC
CCTAGATTCTTTTTTTAAGCACTAAATAGTGAATACCATGGTGTTTGGCTTTTATTTTTTTAAAAAATATTTGTTATGCAAATCTAAAATTACATAAGAATATTTTTTGTCTTACATTGG
GATTTATCAACAACATTATTATTTTAAACATAGATAATTTATTCAATTGGATTTATCAGTTTGAGGGGTTTTTTATTCCAATAAATTTTTGTTACCGTATTCGCGCCGGTTCGTTTTCGC
TCCGTTTTCGGTTTTGATAATATTCGATTCCGTTTTCGTATCCGGGGTTTCCGATTCCGATTCCGATTCCGAAAAAAAATATGAAAACGAAAACGATAAAGATGGTTTCCGTCCGTTTCC
GTACCGTTTTCACCCCTAATTGTAGCTCTATCTGGTGGCCACACCCTGGTGATAATTTCGTTCTCCATTTGAATATAAGCACCTGGTAATTATTTGTATCATCACACTGCCAGGATTGTT
TCTCACAGGGAAAGGCACATCCTGAAAGATCTGGATTTGACGGTGCATGGACCAAGGAACCACTTAAGTTTGACAACTCTTACTTCCTGTAAGCTCAATGTTAAACCATCTATCATACGT
TTGCTTTGGGAACTAGTGATGAGAGATTGATGACATTTTTCTCCATATTCATTTAGAGAACTGCTGAGGGAGGAATCAGAGGGACTTTTGAAACTTCCAACTGACAGGGCTCTCCTGGAA
GATCCTGAATTCAGGCGCTTTGTGGATCATTACGCGAAG
GTAAATGATAGATGATGTATCCTATTCAGAGCTACATGGATGCCTCAGAATATACCTACAACTCCTATCCTCAAATGGCAG

GATGAGGATGCCTTCTTCAAGGACTACGCTGAATCACACAAGAAGCTCTCCGAACTTGGGTTCGCTCCACGTAGCTCTGCAAAATCAGATGGTTCAACGGCTGCTGCTACACTCGCGCAG
AGTGCGTTTGGGGTCGCAGTTGCTGCAGCCGTAGTAGTTATCGCAGGTTACCTCTACGAGTCTTCTAAGAAAACCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCGGTGGTGGACGCGGAGTACCTGCGACAGGTCGAGGGGGCGCGCCGCGACCTCCGCGCGCTCATCGCCTCCAAGGGCTGCGCCCCCATCATGCTCCGCCTCGCATGGCAT
GATGCTGGCACATATGATGCAAAAACAAAAACTAGGGGTGCAAATGGTTCAATTAGGCATGAGGAAGAGTACACTCATGGTTCAAATGCTGGACTAAAAATTGCCATTGATCTCCTTG
AG
CCTATTAAGCGAAAGCATCCAAATATCACTTATGCTGATCTTTATCAG
CTTGCTGGAGTGGTTGCAGTTGAAGTTACTGGAGGTCCAACCGTTGACTTTGTTCCTGGAAGAAGGGACTCA
TCAGTTTGCCCGCGAGAAGGACGTCTTCCTGATGCGAAGAAAG
GTGCACCACATTTAAGAGACATCTTTTATCAAATGGGATTGACTGACAAGGATATTGTAGCTCTATCTGGTGGCCAC
ACCCTG
GGAAAGGCACATCCTGAAAGATCTGGATTTGACGGTGCATGGACCAAGGAACCACTTAAGTTTGACAACTCTTACTTCCTAGAACTGCTGAGGGAGGAATCAGAGGGACTTTTG
AAACTTCCAACTGACAGGGCTCTCCTGGAAGATCCTGAATTCAGGCGCTTTGTGGATCATTACGCGAAG
GATGAGGATGCCTTCTTCAAGGACTACGCTGAATCACACAAGAAGCTCTCC
GAACTTGGGTTCGCTCCACGTAGCTCTGCAAAATCAGATGGTTCAACGGCTGCTGCTACACTCGCGCAGAGTGCGTTTGGGGTCGCAGTTGCTGCAGCCGTAGTAGTTATCGCAGGTTAC
CTCTACGAGTCTTCTAAGAAAACCAAGTAG

Retrieve as FASTA