Entry information : GmPrx02(Glyma.17G013600 / Glyma17g01720.1)
Entry ID 4
Creation 2006-09-15 (Christophe Dunand)
Last sequence changes 2006-09-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-02-27 (Christophe Dunand)
Peroxidase information: GmPrx02(Glyma.17G013600 / Glyma17g01720.1)
Name GmPrx02(Glyma.17G013600 / Glyma17g01720.1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type Seed coats
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx02
start..stop
S start..stop
GmPrx35 650 0 1..330 1..334
PvPrx11 647 0 1..331 1..335
VuPrx01 647 0 1..331 1..334
PcoPrx03 630 0 14..331 14..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1041036..1041257 222 N° 2 1041355..1041543 189 N° 3 1041800..1041965 166 N° 4 1042371..1042789 419
join(1041036..1041257,1041355..1041543,1041800..1041965,1042371..1042789)


exon

Literature and cross-references GmPrx02(Glyma.17G013600 / Glyma17g01720.1)
Literature Gijzen,M., Miller,S.S., Bowman,L.A., Batchelor,A.K., Boutilier,K. and Miki,B.L. Localization of peroxidase mRNAs in soybean seeds by in situ hybridization Plant Mol. Biol. 41 (1), 57-63 (1999).
Protein ref. UniProtKB:   O64970
DNA ref. Phytozome 12:   Gm17 (1041036..1042789)
Cluster/Prediction ref. UniGene:   Gma.30988
Protein sequence: GmPrx02(Glyma.17G013600 / Glyma17g01720.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   37084.16 (34578.8)  
PI (pH):   %s   8.68 (8.55) Peptide Signal:   %s   cut: 25 range:25-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPKGLIFLAVLCFSALSLSRCLAEDNGLVMNFYKESCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYIETIKEALERECPGVVSCADILVLSARDGIVSLGGPHIPLKTGRRDGRRSRADVVEQFLPDHNESISAVLDKFGAMGIDTPGVVALLGAHSVGRTHCVKLVHRLYPEIDPALNPDHVPHILKKCPDAIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLIVDHQLANDKRTKPYVKKMAKSQDYFFKEFSRAITLLSENNPLTGTKGEIRKQCNAANKHHEEP

Retrieve as FASTA  
Remarks Complete sequence from genomic and 257 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGCCATCAAG TTTTCTTCAA GGTGATACTG GCATGAAAAA AAAAAGTAAA ATATTTTCGT ATCATCTATC ACTTTTTTTA TTTTAAAACA TTTAACATTT TGATAAAAAT AAAAACATTT  ATTATTTTTA AAAAATATTA ATTATTTTAC TAATATGCTC AACTAATAAT ATATTATCTA AATATTTAAC TAATTCACAA CTATATTTAA CTATTTTAAT AAAAATAATC TTTAACCCAC  TTTTTATTAT TAACTAAAAT TTAGCCTTTC AAAAAATTAT TAATTAAAAT ATATTAAAAA CTATAAAATT ATATAATTCT CACTCCAACG GTCCTACTTA ATAAACTCTC TTTATAATTT  TTAATAAATA TTAACTAATA AAAACATATT GTGTTAAATA ATGTTTCACT AACACTCCTC TGCATCGTGT TGCTTCCAAC TTTAATACTT TAATTAATTA TACAAAACAA TTCAAAGGAA  AGACGCGACA TTGACCATTG AATAGAGTGA TGGACGTACA CTTTTTTGTT TTATAGCATA GCATTTTTAA ATGGTTGATG CCCATACTTT TTTCCATTGG GATTAAAGTT TGGGAGGTGG  CGGTAAATTC TTTCCATCTG CACGTCGAAA GCATTTGGGA TTGTGCTCAT ATTGTTTTTA ACAAGTGGGG TTGTCCTCAT ATTATAACTT CTTTTTTTTT AACTATATTT TAAGCGGAAG  AAAAAAATAT TGTGGGGAGA GCTACCCCAA AACTTCTAAT GTAGATCCGT TTCTAAATGT ATAATATTGG TTTATGTGAC AATATTTTTC TTTTTTTGTG TGTGGTAAGC ATGGTGTTGT  ACTATATCAT AATTACACAA ATATACTTTA ATATTAATTT TTTGTTATAT TTCAAAAAGG ATAAACGTAT AATCTATCTC AAATTATACA AGTAATCATT CAATTATTAA AAATCACACT  ACATAGTTTC CTAAGAATTT TCAAATTAGT TCGTGACCAT TAGTAAAATA TATTAATGTG AAAATTAAAT CAATAAATAT TTAATATTTT AGAGACTATT TATATAATTT TATTACTTTA  AAGGTTATTT AGAGAGAGAG TAATACTCTA AAATGGATGA TTTTATAGAA GAAGGATTTG GATTATTTTT ACAAACTCAA ATTAAGTTTA CGCATTTTAG TCCAAACGTG TACACCTCTG  GTGGGAACTG GGAACTGGGA ACTGAGGAAA TGAAGGAAGG TTGAAAATGA CTTTCACAAG CCGCACTGTG CCAAGCCCCT TGAAATAGCT GACTTTCTCA GCTGGTGTTG CTCGTTTGCT  TTGCCAAGTG CAAACAATTT TTGCCATTTC TCAATAAAAA AACATGGAAT CTATCCGAAA TCCTGAAATC TTTGTGCAAG TTCCGTTACT TACTACTCTT TTTTCTCTTA ACATTATACT  TACTATTACT TATTTATATT TTTTTAATAT GTCAAATAAT ATGAAGTATT TGTACATTTT TATCCTATTA TGTTTATGTT TATAAATAAA ATAAAATTTT ATTATTAAAA AATATATTAA  GAAATTAATA AAATATAATT AATTTAAAAT GAATTAACTG GTTGACGCAT GAAATTAGTT GGGCGACGTC AGAAACACTT CATATTTTCC GTGGCTTCTA CGCACCAGAG TCCAAAATTT  AAAGTTTTGT AGCTGAAAAT AGGAAAAGAA AAGTTGCAAC GAATCCCGTA GCCTAGGCAC ATCACATGGT CAGTAATTAG TTTAATAAAT GCTAGCTCGT AGTGAGTGCT GGATCATGAT  GAAAGCATCA ACATCACCCT TTAACCTAAA GTATTAAAAT GTTGGTTTAT TATTATTACT CATAGCTCAA AACCCAATTT TACCCTACCA ATTAAGGTCT CTCATACAGT AGTATTTTAT 
TTGCACTACG TACTGGCTAC TTTATTTATT TAAGCAGAAG CAGGTGAGTG AGTGAGTGAG CAAGAGTGAA GAGCGAAGAG A 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAGGGTTTAATCTTTTTGGCTGTGTTATGCTTCTCAGCACTGTCACTGAGTCGTTGTCTTGCGGAGGATAATGGACTTGTTATGAACTTCTACAAGGAATCATGCCCTCAG
GCTGAAGACATCATCAAAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCTTTCTCCTGGCTCAGAAACATCTTCCATGACTGTGCTGTTCAG
GTAACTAAAACTTTGCTT
TTTTGTCAGTTAATTTTTTATATATGAAAGTATTTGTTCTTTACTCTTTTTTTTTGTGTGTGTGTGTGTGTGAGGGTAGAGTTGTGATGCTTCACTGTTGCTGGACTCCACAAGAAGGAG
CTTGTCTGAGAAGGAAACAGATAGAAGCTTTGGGTTGAGAAATTTCAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGGGAATGCCCAGGAGTTGTTTCCTGTGCTGATATCCTCGT
TCTCTCTGCCAGAGATGGCATTGTTTCG
GTAATTTACTCCTTCTCTTCTGTTTCCCACTTTGCTCAACCTCACTCACTAGATCTGTCATTTGCTAGCACTTCTTTTTCGTATGTTCATCA
CCAAGTTCACTCTTGAAAGCTAAAGTTTATATACATATACCCTATCCATAATTCTAGCAAGATCGGTCTATTTTTAGTATAAGGAGATTTGTTTTGGCAACTGCTTTAATTCATTATTAA
AGTGAGAATTTATTCTTGTAATTAATTTGATGTGTTGAATGCAGCTAGGAGGTCCCCATATCCCTCTTAAAACAGGAAGAAGGGATGGTAGAAGGAGCAGAGCCGATGTGGTAGAGCAGT
TCCTCCCAGACCACAATGAATCCATTTCTGCAGTTCTTGACAAGTTTGGTGCCATGGGAATTGACACCCCCGGCGTAGTTGCATTGCTTG
GTACTATACACTCTCCCCTAACCCATCCAT
CATCCATGTACATACATTCGTGAAATGACATCCTCTCATACACCACAAATTATTATATGATATGATCAATCATCTCAGCTGATCTCCACATAACATATAATTAAGTTACAGCATACGTAA
TAATAATTTGTCTACATATATGTATTCATAAAGCATACATAAACTTTATGCATCACAATTCTTTTAATAAATATATGTGGGCCCCGCATGATTAATCAGAGAGATAAAGCCAGATGCAAC
TAGACAACATATATGAAAGATGCAACACCCTTATGTATGCATGGGTACATGACATGCTAAAAGAAAGTACACGTGGCATTGTTGCTTGTGATTTTATTTAAGTTTGAATAATGATTGAGA
TATTTTGTTGAACAGGAGCACACAGTGTTGGTCGAACCCATTGTGTGAAGTTGGTGCACCGTTTGTACCCAGAGATTGATCCAGCTCTGAACCCTGACCACGTCCCTCACATTCTGAAGA
AGTGCCCTGATGCCATTCCAGACCCTAAGGCCGTGCAGTACGTGAGAAACGACCGTGGCACCCCCATGATTCTAGACAACAATTACTACAGAAATATATTGGACAACAAGGGCTTGTTGA
TAGTGGATCACCAACTAGCCAATGACAAGAGGACCAAGCCTTATGTGAAGAAAATGGCCAAGAGCCAGGACTATTTCTTCAAGGAGTTTTCTAGAGCCATTACTTTGCTCTCTGAGAACA
ACCCTCTCACTGGCACAAAGGGTGAGATCAGAAAGCAGTGCAATGCTGCCAACAAGCACCATGAGGAGCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCAAGGGTTTAATCTTTTTGGCTGTGTTATGCTTCTCAGCACTGTCACTGAGTCGTTGTCTTGCGGAGGATAATGGACTTGTTATGAACTTCTACAAGGAATCATGCCCTCAG
GCTGAAGACATCATCAAAGAACAAGTCAAGCTTCTCTACAAGCGCCACAAGAACACTGCTTTCTCCTGGCTCAGAAACATCTTCCATGACTGTGCTGTTCAG
AGTTGTGATGCTTCACTG
TTGCTGGACTCCACAAGAAGGAGCTTGTCTGAGAAGGAAACAGATAGAAGCTTTGGGTTGAGAAATTTCAGGTACATTGAGACCATCAAAGAAGCTTTGGAAAGGGAATGCCCAGGAGTT
GTTTCCTGTGCTGATATCCTCGTTCTCTCTGCCAGAGATGGCATTGTTTCG
CTAGGAGGTCCCCATATCCCTCTTAAAACAGGAAGAAGGGATGGTAGAAGGAGCAGAGCCGATGTGGTA
GAGCAGTTCCTCCCAGACCACAATGAATCCATTTCTGCAGTTCTTGACAAGTTTGGTGCCATGGGAATTGACACCCCCGGCGTAGTTGCATTGCTTG
GAGCACACAGTGTTGGTCGAACC
CATTGTGTGAAGTTGGTGCACCGTTTGTACCCAGAGATTGATCCAGCTCTGAACCCTGACCACGTCCCTCACATTCTGAAGAAGTGCCCTGATGCCATTCCAGACCCTAAGGCCGTGCAG
TACGTGAGAAACGACCGTGGCACCCCCATGATTCTAGACAACAATTACTACAGAAATATATTGGACAACAAGGGCTTGTTGATAGTGGATCACCAACTAGCCAATGACAAGAGGACCAAG
CCTTATGTGAAGAAAATGGCCAAGAGCCAGGACTATTTCTTCAAGGAGTTTTCTAGAGCCATTACTTTGCTCTCTGAGAACAACCCTCTCACTGGCACAAAGGGTGAGATCAGAAAGCAG
TGCAATGCTGCCAACAAGCACCATGAGGAGCCTTAA

Retrieve as FASTA