Entry information : TaPrx03 (TAPOX3)
Entry ID 40
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-03-03 (Christophe Dunand)
Peroxidase information: TaPrx03 (TAPOX3)
Name (synonym) TaPrx03 (TAPOX3)
Class Class III peroxidase    [Orthogroup: Prx085]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Triticum
Organism Triticum aestivum (bread wheat)    [TaxId: 4565 ]
Cellular localisation N/D
Tissue types Inflorescences
Leaves
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaPrx03
start..stop
S start..stop
TmPrx01 620 0 1..312 1..312
TaPrx113-1A 613 0 1..312 1..312
AvePrx113-1A 613 0 1..312 1..312
TaPrx113-1D 597 0 1..312 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 216..422 207 N° 2 523..699 177 N° 3 781..1335 555  
join(216..422,523..699,781..1335)


exon

Literature and cross-references TaPrx03 (TAPOX3)
Protein ref. UniProtKB:   Q43219
DNA ref. GenBank:   X85229.1 [5' end]
Cluster/Prediction ref. UniGene:   Ta.50739
Protein sequence: TaPrx03 (TAPOX3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (290)
PWM (Da):   %s   32504.07 (30430.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.64 (5.64) Peptide Signal:   %s   cut: 23 range:23-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASASYLSLVVLVALAAVVSGQLSPTFYDTSCTRALATIKSGVMAAVSSDPRMGASLLRLHFHDCFVQGCDASVLLSGMEQNALPNNGSLRGFGVIDSIKTQIEAICAQTVSCADILTVAARDSVVALGGPSWTVPLGRRDSIDANEAAANSDLPGPTSSRSDLELAFSNKGLLTVDMVALSGAHTIGQAQCGTFKDRIYNETNIDTTFATSLRANCPRSGGDGSLANLDTTTANTFDNAYYTNLVSQKGLLHSDQVLFNNDTTDNTVRNFASNPAAFSSAFTTAMIKMGNIAPKTGTQGQIRLSCSRVNS*

Retrieve as FASTA  
Remarks Complete sequence from Genomic (3'end is missing) and ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCTCTGCCTCTTACCTTTCTCTGGTGGTGCTCGTGGCTCTGGCCGCCGTGGTGTCGGGGCAGCTGTCGCCGACGTTCTACGACACATCCTGCACAAGGGCCCTGGCCACCATC
AAGAGCGGCGTCATGGCCGCCGTGAGCAGCGATCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAA
GTAAGTTGGCCACATGCATGCATGCATATCCCG
ATAGCCGTCACGTACCCTGTTTTGTATAGGTTTTGCTTGCTAAACACTATAAGCATGTGATGTGCAGGGCTGTGACGCGTCTGTTCTGCTTTCTGGCATGGAACAAAACGCTCTCCCGAA
CAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCTGCCCGTGACTCCGTTGT
CGCC
GTAAGAATATCATCTTACGATCGTGTACATCATCGATTGGATGCCATCGTTAACCGTTTTCTTCGTATCCTTCGCGTGCAGCTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAG
AAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCTAGCCGGTCAGATCTTGAGCTGGCATTCAGCAACAAGGGCCTCCTTACGGTCGACATGGT
GGCCCTCTCCGGCGCGCACACCATCGGCCAGGCGCAGTGCGGGACCTTCAAGGACAGGATCTACAACGAGACTAACATCGACACGACCTTCGCCACATCTCTCCGGGCCAACTGCCCCCG
GTCCGGCGGCGACGGCAGCCTGGCGAACCTCGACACGACGACGGCCAACACGTTCGACAACGCCTACTACACCAACCTCGTGTCACAGAAGGGGCTCCTGCACTCGGACCAGGTGCTGTT
CAACAACGACACCACCGACAACACCGTCCGGAACTTCGCGTCCAACCCGGCAGCGTTCAGCAGCGCGTTCACGACGGCCATGATCAAGATGGGCAACATCGCGCCGAAGACGGGGACGCA
AGGGCAGATCAGGCTCAGCTGCTCCAGGGTGAACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCTCTGCCTCTTACCTTTCTCTGGTGGTGCTCGTGGCTCTGGCCGCCGTGGTGTCGGGGCAGCTGTCGCCGACGTTCTACGACACATCCTGCACAAGGGCCCTGGCCACCATC
AAGAGCGGCGTCATGGCCGCCGTGAGCAGCGATCCTCGGATGGGCGCGTCGCTGCTCCGGCTGCACTTCCACGACTGCTTCGTCCAA
GGCTGTGACGCGTCTGTTCTGCTTTCTGGCATG
GAACAAAACGCTCTCCCGAACAACGGGTCACTGCGGGGCTTCGGCGTCATCGACAGCATCAAGACACAGATCGAGGCCATCTGCGCCCAGACCGTCTCCTGCGCCGACATCCTCACCGTC
GCTGCCCGTGACTCCGTTGTCGCC
CTCGGAGGGCCATCATGGACAGTCCCTCTGGGAAGAAGGGATTCCATAGATGCAAACGAGGCGGCGGCAAACAGCGACCTCCCAGGCCCTACGTCT
AGCCGGTCAGATCTTGAGCTGGCATTCAGCAACAAGGGCCTCCTTACGGTCGACATGGTGGCCCTCTCCGGCGCGCACACCATCGGCCAGGCGCAGTGCGGGACCTTCAAGGACAGGATC
TACAACGAGACTAACATCGACACGACCTTCGCCACATCTCTCCGGGCCAACTGCCCCCGGTCCGGCGGCGACGGCAGCCTGGCGAACCTCGACACGACGACGGCCAACACGTTCGACAAC
GCCTACTACACCAACCTCGTGTCACAGAAGGGGCTCCTGCACTCGGACCAGGTGCTGTTCAACAACGACACCACCGACAACACCGTCCGGAACTTCGCGTCCAACCCGGCAGCGTTCAGC
AGCGCGTTCACGACGGCCATGATCAAGATGGGCAACATCGCGCCGAAGACGGGGACGCAAGGGCAGATCAGGCTCAGCTGCTCCAGGGTGAACTCGTGA

Retrieve as FASTA