Entry information : MtPrx75 (Medtr6g043460.1[4.0] / contig_84121_2.1 [3.5])
Entry ID 400
Creation 2005-06-16 (Christophe Dunand)
Last sequence changes 2014-07-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-07-30 (Christophe Dunand)
Peroxidase information: MtPrx75 (Medtr6g043460.1[4.0] / contig_84121_2.1 [3.5])
Name (synonym) MtPrx75 (Medtr6g043460.1[4.0] / contig_84121_2.1 [3.5])
Class Class III peroxidase    [Orthogroup: Prx087]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducers Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx75
start..stop
S start..stop
GmPrx36 459 9e-164 33..344 31..341
PvPrx16 427 1e-150 21..328 24..334
GmPrx32 408 2e-143 1..348 2..352
PvPrx14 400 2e-140 1..348 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15051843..15052085 243 N° 2 15050900..15051094 195 N° 3 15050121..15050729 609  
complement(join(15050121..15050729,15050900..15051094,15051843..15052085))


exon

Literature and cross-references MtPrx75 (Medtr6g043460.1[4.0] / contig_84121_2.1 [3.5])
Literature Cote,F. et al., unpublished
DNA ref. Phytozome 11:   chr6 (15052085..15050121)
Cluster/Prediction ref. Phytozome Gene 11:   31104031 UniGene:   Mtr.9983
Omic ref. Gene atlas:   Mtr.38549.1.S1_at Legoo:   Mtr.38549.1.S1_at
Protein sequence: MtPrx75 (Medtr6g043460.1[4.0] / contig_84121_2.1 [3.5])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 348 (324)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
38586.61 (36062.2)  
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
5.45 (5.27) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 25 range:25-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMVSASRSLFISFLLASLILVSSERVARPPAVRGLDYDFYRLSCPRIERIVRKHLEDVFEKDSGQAPGILRLFFHDCFSQGCDASILLNGVDGEDDEKQHDANFALREEALQTIENIRAIVRKQCPRVVSCADILVIAAREAVRQFGGPDIDVPLGRKDSLNFSVNSPDNLPVPFARTDELLTVFGSKKFDATDVVALSGAHTFGQAHCPTMFNRVIDSDPPIEPNFKKQLEATCPNEESLNAVNLDVRTPNTFDNMYYINLLNHQGVFTSDQDLASHPKTKEIVNLFASNQKEFFNKFANAFVKVSQLDVLTGNQGEIRKSCFAPNNRKSKVATVVEEVVEIVANM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, introns 1 and 2) and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGTTAGTGCAAGTAGATCTCTTTTTATTTCTTTTCTATTAGCTTCTCTAATCCTTGTTTCCTCTGAGAGAGTAGCAAGGCCTCCTGCTGTGAGGGGACTTGACTATGATTTC
TATCGGTTGTCATGTCCTAGGATTGAAAGGATTGTAAGGAAACATCTTGAAGATGTTTTTGAAAAGGATAGTGGTCAAGCTCCTGGCATACTCAGACTCTTTTTCCATGATTGCTTTTCT
CAG
GTATGATTTAAGATTGTTCTCAAAACCTTACTTTCTTTTTATCGACGTGTCTATTATGAACCTCTAAAAAATGATTCAATAGTTGATCCACCGTTATATCAAGTCCAAGTTAGACAG
ATCCCATTTTATTAAATGGTTTCGAAAATCGTATAACAAAAGAATGGAGGAGAGCAAAAGTATTAATGTGGATTTATATTTTTTTTTAAGAAGCTTAAGTAGAATTAAATTTAACAAAAC
AATCCAACCATATAGAAGTGCTAAGATTGAAAGGATACATAAGTTAATAAACAAAAGGCGCCAAAACATATCGGTGATATCAACCCAACAACACATCAGAAAAACAATATCCAAGAGTAG
TCACAACATATTTCACAAGTGGTAAAAAAATGACAAAAACTCGATTTTTGAATTGAGAATTAAGTTAATTTTGAAGAAAATCCAAAACTCAGTTAAGCCTATTAATAAACAAGGAAAAAC
GATAATCTTTTATAAACAAGAATAATAAAAATTTGCCTTTAACTTTTTTTACCTTCAGAGTTCACACTTCACACTATGTACCCATTTATTTCCATGCATATTTTTCTGTGTGTGGAATTG
TTTCACATGAGATTTAAATTTTATAATTGAGCTGACATCTCGAGGTCAAATATCCTACATAGTTTTTTTTATTTCTATGTAATTGAAAATATTAAATGTTGATTTGTGCCATTAAAAAAA
AAATTAAATGTTGATTTTTGGAGTGAAACAGGGATGCGATGCGTCTATTTTGTTGAATGGTGTTGATGGAGAAGATGACGAAAAACAACATGATGCCAACTTCGCTTTAAGGGAGGAGGC
TCTTCAAACCATTGAAAACATTCGTGCTATAGTCCGTAAGCAGTGTCCACGGGTTGTCTCGTGCGCAGATATCCTCGTCATTGCTGCACGCGAAGCTGTTCGCCAA
GTAATTTCTATTTA
TTTGTTCACTCTCTTTTGTTTCTTTTTTCGGTTTATTTAAAATAATATAGATCTCATAATATGACAATTATAATTGGTTGAAACTATAAAAACTATTTTTTTGATAGTGGATACAAATTA
ATTCTTCTTTGAATTGCTTCCCTTGAATTTGTACAGTTTGGAGGCCCAGATATTGACGTGCCATTGGGAAGAAAAGACAGCCTAAACTTCAGTGTAAACTCACCAGATAATCTCCCGGTA
CCATTTGCACGAACAGATGAACTATTAACCGTTTTCGGATCAAAAAAATTCGATGCAACCGATGTAGTTGCTCTATCCGGTGCTCACACTTTCGGTCAAGCTCATTGTCCTACAATGTTC
AACCGAGTCATTGATTCCGACCCACCAATCGAACCAAATTTCAAGAAACAACTTGAAGCAACATGTCCGAATGAGGAATCCCTCAACGCCGTTAATTTGGATGTTCGAACACCAAACACA
TTCGATAATATGTACTACATTAACCTCTTGAATCACCAGGGTGTATTTACATCTGATCAAGATTTGGCAAGTCATCCTAAGACTAAGGAGATTGTTAACCTCTTTGCTTCAAACCAGAAA
GAGTTTTTTAACAAATTTGCTAATGCTTTTGTTAAGGTAAGTCAATTGGATGTTTTGACCGGAAATCAAGGAGAAATTCGTAAGTCATGTTTTGCTCCAAATAATAGGAAATCTAAGGTG
GCAACTGTGGTGGAAGAGGTCGTGGAAATTGTAGCAAACATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGTTAGTGCAAGTAGATCTCTTTTTATTTCTTTTCTATTAGCTTCTCTAATCCTTGTTTCCTCTGAGAGAGTAGCAAGGCCTCCTGCTGTGAGGGGACTTGACTATGATTTC
TATCGGTTGTCATGTCCTAGGATTGAAAGGATTGTAAGGAAACATCTTGAAGATGTTTTTGAAAAGGATAGTGGTCAAGCTCCTGGCATACTCAGACTCTTTTTCCATGATTGCTTTTCT
CAG
GGATGCGATGCGTCTATTTTGTTGAATGGTGTTGATGGAGAAGATGACGAAAAACAACATGATGCCAACTTCGCTTTAAGGGAGGAGGCTCTTCAAACCATTGAAAACATTCGTGCT
ATAGTCCGTAAGCAGTGTCCACGGGTTGTCTCGTGCGCAGATATCCTCGTCATTGCTGCACGCGAAGCTGTTCGCCAA
TTTGGAGGCCCAGATATTGACGTGCCATTGGGAAGAAAAGAC
AGCCTAAACTTCAGTGTAAACTCACCAGATAATCTCCCGGTACCATTTGCACGAACAGATGAACTATTAACCGTTTTCGGATCAAAAAAATTCGATGCAACCGATGTAGTTGCTCTATCC
GGTGCTCACACTTTCGGTCAAGCTCATTGTCCTACAATGTTCAACCGAGTCATTGATTCCGACCCACCAATCGAACCAAATTTCAAGAAACAACTTGAAGCAACATGTCCGAATGAGGAA
TCCCTCAACGCCGTTAATTTGGATGTTCGAACACCAAACACATTCGATAATATGTACTACATTAACCTCTTGAATCACCAGGGTGTATTTACATCTGATCAAGATTTGGCAAGTCATCCT
AAGACTAAGGAGATTGTTAACCTCTTTGCTTCAAACCAGAAAGAGTTTTTTAACAAATTTGCTAATGCTTTTGTTAAGGTAAGTCAATTGGATGTTTTGACCGGAAATCAAGGAGAAATT
CGTAAGTCATGTTTTGCTCCAAATAATAGGAAATCTAAGGTGGCAACTGTGGTGGAAGAGGTCGTGGAAATTGTAGCAAACATGTAG

Retrieve as FASTA