Entry information : Os1CysPrx02 (RAB24)
Entry ID 4024
Creation 2006-11-03 (Nicolas Rouhier)
Last sequence changes 2006-11-03 (Nicolas Rouhier)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: Os1CysPrx02 (RAB24)
Name (synonym) Os1CysPrx02 (RAB24)
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation Nucleus
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Os1CysPrx02
start..stop
S start..stop
Osi1CysPrx02 451 2e-164 1..220 1..220
Os1CysPrx01 379 5e-136 1..219 1..219
Osi1CysPrx01 379 7e-136 1..219 1..219
Hv1CysPrx 358 9e-128 1..219 1..218
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26498201..26498318 118 N° 2 26498422..26498570 149 N° 3 26498685..26499080 396  
join(26498201..26498318,26498422..26498570,26498685..26499080)


exon

Literature and cross-references Os1CysPrx02 (RAB24)
Literature Gama et physiologia plantarum in press;
Dietz et al The function of peroxiredoxins in plant organelle redox metabolism.
J Exp Bot. 2006;57(8):1697-709.
Protein ref. UniProtKB:   P0C5D1
DNA ref. GenBank:   NC_008400.1 (26498201..26499077)
Cluster/Prediction ref. UniGene:   Os.11218
Protein sequence: Os1CysPrx02 (RAB24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   220
PWM (Da):   %s   24102.3  
PI (pH):   %s   5.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGLTLGDVVPDLELDTTHGKIRLHDFVGDAYVIIFSHPADFTPVCTTELSEMAGYAGEFDKRGVKLLGFSCDDVESHKDWIKDIEAYPGRRVGFPIVADPDREAIRQLNMIDADEKDTAGGELPNRALHIVGPDKKVKLSFLFPACTGRNMAEVLRATDALLTAARHRVATPVNWKPGERVVIPPGVSDEEAKARFPAGFETAQLPSNKCYLRFTQVD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, 2 introns), 3 cDNA and 60 ESTs. Cultivar="Japonica". Tandem sequence with Os1Cysprx01.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGGACTCACCCTCGGCGACGTCGTCCCCGACCTGGAGCTCGACACCACCCACGGCAAGATCCGCCTCCACGACTTCGTCGGCGACGCCTACGTCATCATCTTCTCCCACCCCGGT
ATATATAGTGTACTACTGCATTACTGTCGTACTGCGTGTGTCCGTGCAGCAGACGAGCTTGAGAAGTTGAGATGTTGATCAAATCCGTGCGTGCATTTCAGCTGACTTCACGCCGGTCTG
CACGACGGAGCTGTCGGAGATGGCGGGCTACGCCGGCGAGTTCGACAAGAGGGGCGTCAAGCTCCTCGGCTTCTCCTGCGACGACGTCGAGTCGCACAAGGACTGGATCAAGGACATCGA
GGCCTACAAG
GTATGTACACGATCGAGTTCATCGCATTCATCAATCCTTGACTGATTGATACATTTGCAGAGTCGTATCTGATTATAATTTCTTGGTTCAATTTGTGATCGATGGTTGCT
TTAGCCTGGCCGCCGCGTCGGCTTCCCGATCGTCGCCGACCCGGACAGGGAGGCGATCAGGCAGCTCAACATGATCGACGCCGACGAGAAGGACACCGCCGGCGGCGAGCTCCCCAACCG
GGCGCTCCACATCGTCGGGCCGGACAAGAAGGTGAAGCTGAGCTTCCTGTTCCCGGCGTGCACGGGGCGGAACATGGCGGAGGTGCTGCGCGCGACGGACGCGCTGCTGACGGCGGCGAG
GCACCGGGTGGCGACGCCGGTGAACTGGAAGCCCGGCGAGCGCGTCGTCATCCCCCCCGGCGTCTCCGACGAGGAGGCCAAGGCGAGGTTCCCGGCCGGGTTCGAGACCGCCCAGCTGCC
CTCCAACAAGTGCTACCTCCGCTTCACCCAGGTGGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGGACTCACCCTCGGCGACGTCGTCCCCGACCTGGAGCTCGACACCACCCACGGCAAGATCCGCCTCCACGACTTCGTCGGCGACGCCTACGTCATCATCTTCTCCCACCCCGCT
GACTTCACGCCGGTCTGCACGACGGAGCTGTCGGAGATGGCGGGCTACGCCGGCGAGTTCGACAAGAGGGGCGTCAAGCTCCTCGGCTTCTCCTGCGACGACGTCGAGTCGCACAAGGAC
TGGATCAAGGACATCGAGGCCTACAAG
CCTGGCCGCCGCGTCGGCTTCCCGATCGTCGCCGACCCGGACAGGGAGGCGATCAGGCAGCTCAACATGATCGACGCCGACGAGAAGGACACC
GCCGGCGGCGAGCTCCCCAACCGGGCGCTCCACATCGTCGGGCCGGACAAGAAGGTGAAGCTGAGCTTCCTGTTCCCGGCGTGCACGGGGCGGAACATGGCGGAGGTGCTGCGCGCGACG
GACGCGCTGCTGACGGCGGCGAGGCACCGGGTGGCGACGCCGGTGAACTGGAAGCCCGGCGAGCGCGTCGTCATCCCCCCCGGCGTCTCCGACGAGGAGGCCAAGGCGAGGTTCCCGGCC
GGGTTCGAGACCGCCCAGCTGCCCTCCAACAAGTGCTACCTCCGCTTCACCCAGGTGGACTGA

Retrieve as FASTA