Entry information : GgaPOX02 (GgaMPO)
Entry ID 4040
Creation 2007-02-02 (Marcel Zamocky)
Last sequence changes 2011-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-01 (Christophe Dunand)
Peroxidase information: GgaPOX02 (GgaMPO)
Name (synonym) GgaPOX02 (GgaMPO)
Class Non mammalian vertebrate peroxidase    [Orthogroup: POX001]
Taxonomy Eukaryota Metazoa Chordata Aves Phasianidae Gallus
Organism Gallus gallus    [TaxId: 9031 ]
Cellular localisation N/D
Tissue types Mixed tissues
Ovaries
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgaPOX02
start..stop
S start..stop
OgaMPO 895 0 45..736 20..716
HsEPO 886 0 35..736 10..713
MmMPO 886 0 55..736 30..716
PtroEPO 885 0 35..736 10..713
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..73 73 N° 2 582..659 78 N° 3 1276..1369 94 N° 4 2266..2441 176
N° 5 3205..3328 124 N° 6 4164..4293 130 N° 7 4491..4697 207 N° 8 5632..5947 316
N° 9 7427..7587 161 N° 10 7907..8153 247 N° 11 8654..8824 171 N° 12 9831..10068 238
N° 13 10248..10471 224 N° 14 10875..10897 23  
join(1..73,582..659,1276..1369,2266..2441,3205..3328,4164..4293,4491..4697,5632. .5947,7427..7587,7907..8153,8654..8824,9831..10068,10248..10471,10875..10897)


exon

Literature and cross-references GgaPOX02 (GgaMPO)
Literature Zamocky M. et al. (2007) Phylogenetic relationship in the peroxidase-cyclooxygenase superfamily (in preparation). This record is predicted by automated computational analysis. This record is derived from an annotated genomic sequence (NW_060634) using gene prediction method: GNOMON, supported by EST evidence.
DNA ref. GenBank:   NW_001471508.1 (425469..414166)
mRNA ref. GenBank:   XM_415716.2
Cluster/Prediction ref. UniGene:   Gga.23215
Protein sequence: GgaPOX02 (GgaMPO)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   753
PWM (Da):   %s   84936.09  
PI (pH):   %s   9.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSDEQISPGAAASNPETFSAFESGMKAETCFLVLLAKIILFRGSASSSYDLPEKLSDAFLLSSVDEAKQLVDSAYKDTRDRIKKNLENDALNPIELLRYFKQPVAGTRAAIRAADYMGTTLTLLKEKLSRVVKGDFNVDMLTPAQMGLLFKVTGCEEQNKKVNCEFSSRYRTITGKCNNRRNPLLGASNRALARWLPADYEDGVSIPHGWTNRRCSFGYPFPVRRVSNEIVRFPPGQLKFDQQRSLMFMQWGQFIDHDLDFSPESPARVTFNGRVDCHTSCAKLPPCFPIQIPPNDPRIKNTRDCIPFFRSAPACDSGRATREQINALTSFLDGSMVYGSEQHLANRLRNWNNQLGLLAVNQNFTDNGMAYLPFVRMSKDPCLKVSGSANIPCFLAGDSRASEMLELACMHTLFVREHNRLAIGLKRLNPHWNGERIYQEARKIVGAMIIITYRDYLPLLLGRNLQRWIPSYKGYKESVDPRISNVFTLAFRFAHASIPPSVGRLNQNYQSTYPKLKLSKTFFGVWHIVKGGGIDPFLRNLMASKAKLMTQDQMMVDELRDHLSEQIERIGLDLAALNMQRGRDHGLPGYVSWRKFCGLPQPYDVRSLGQVLKNKNLARKFMKLYGTPRNIDIWVGALAEPFVDGGRVGPLMACLIGTQFRNTRDGDRFWWENTGVFTAQQRSSLAKISLSRIICDNTHITKVSRNIFQANSYPHSFVSCSSIPKLDLRAWKSNCMEESTEEETPGDQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 19), 1 mRNA and 8 ESTs. Annotated as "similar to myeloperoxidase precursor". Fused protein, positions: 284-836 heme peroxidase domain, good structural correlation with myeloperoxidase (contrast to GgaPOX01); 930-1058 acyltransferase (pfam01553)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGTGATGAGCAGATCTCCCCCGGAGCTGCTGCCTCCAATCCTGAGACTTTTTCAGCCTTTGAGAGCGGTAAAGGGTGAAGCCGGGGAGAGGAATCCTATTCCCATCAGACATCC
CCAGTGGGAGCCCATGACCCCCAAACCATTGCAAGGTGCTGCCTCATCCTGGTGGGTGTGCAGGGCCATTTGTGGGGCACACGGAGTCCCTGCTGGGAGCTGGGCTGGGCAGCAGGCGCT
GCTCTGCTTTGGCCCCACCAACCCAGGGGGCAGTTCCCCATGGCTCAGATATCCCGTGGCAGATAACAACGCGCTGCAGATAAAAGCATGGCCACAGAGGGGGGCACAGGGAGGACAGCA
GAAGACAGCAGGTGAGAATCTGGCTCGTTGCACACTTGCTTTTGCTTTCATGGAAGATGCTGCTGCTGCAGGGGAAGGCCTTGCTGGGCAGTGTGCATGCTGGGGGAGCATTGCATTGGG
AAGGGGGCACTCTGTATGCTCCCTTAATGTGTTCCATCTGCACCACTCATGGTCAGATCCATGGCTTCCCGACTTTCCTCGTTCCTTACCTTTCTTTGCAGGGATGAAGGCAGAAACCTG
CTTCCTGGTGTTGCTGGCGAAGATCATCCTGTTCCGGGGATCTGCATCTTCTTCCTATG
GTATTGTCTCTTTCTCAGATTTTGCAGATCAGGGGCCTTTATGTTCTGAGTAGGAAAAAGA
ATAAAGTTAAGTCTAAGAGAATCTGATCTCTTGTAAGCTAGCTGAGTCCCATACGGTGAGAAGAGTAATCAGTTTGTATCTATAGGGCCAGCAATGCTGACAATTTCAGGTTTTTTCAGT
AAATTTCCTGTCTGATTTCCTAAAACCACATTAAAGGAGAGCTCAGTTCTCAAAGCAGCTCCATCCCCAGCGTGCAGCAGTTCTCCCAGCCCAACTCAGATCAACTCTTGGTCAATCAGA
GATGACAGTTCAAAGAATATTGGGAGGATTTGGAGATTTTTGTCCCCTTTGTGTCGTTTCTGAAGCTTTCTGTTCTCCTGGAGGTGATCCCACTCAGAGAAGCACTGTAGGGGCCTCCCC
CGCTGTTCTGTAGCCACAGCCGGCCAATGATGGGCATACCCAGAGGGGCTGTGTTATGTGCCCCCGAAGAACTTATTTATACATGGATGTATTGGCACTGCAATGCCAGTACCCCTGGCT
CTGGAGGTGCAAAGTGAAGCCCCCCGTGGCACAGGGAAGTGCTCTCACCTCTGCTCTTTCCTTTCCCCCAATGAGATTTGCCTGAGAAGCTGTCGGATGCGTTCCTGCTGAGCAGTGTGG
ACGAGGCCAAGCAGCTCGTGGATTCAGCCTACAAGGACACACGTGATCG
GTGAGCGTTGGGGTTGGACACTGCTCTCGTGGGCGTGAGCCACAGCCACGCTCTGGTCTTCTCTGTCACGT
TCTGGAGGTGCCACAGCCCTTCTTTAGAGTCACTGAATGGCTTAGGTTGGAAGAGATCTCAAAGCCCCATCCAGCTCCAACCCCTGCCACGGGCTGGTTGCTACCCTCTAGATCAGATTG
CACAAAGCCTCATTCGTGTTGGCTTTGAACACCTCCCGTCTCCCTTTCAGACACTGCTGAGGTTCCCATTCCCTTCCTTTCTGCCCGTGCTCAGAGGGAGCAAACCGCTGTGGGCTGTGG
TCAGAACATTCTGAGGGATCTGACCAGCTTTAGCCACTGTGCTGTGAGAGCGTTTGGCTTCCTACCAACCCATAAACCTCCTCCTTCAGCAGCCATCCTCCAAAAGCCCCTCGGTACCTC
AGGACCTGTCCATCTGAGAGCTCTTCGGAGCTCCAGGTTAAGGTAGGGTGACCTGGAAAGTTTGGGACCTCTGTATGGAAACAGATGCCTGCAGGCGTTTATGAGTTGGGGTCCTCAGCA
GAACGAGGTTTGATTGCCCCAAGGACACAAAGACCACGAGCTCAGCCATTTTCTGGCAGATAGAGCTGGGAAACTGAGATTTCAGCCCTGCTCCTCTGCCAAGGCTGGTGCGGGCTGTGA
GATCACAGGATAACAGGACCAGGGATTGGAAGGGACCTCCAGAGATGCTCGAGCCCAACCCTAAAATCAGGTTCCCTACAGTAGGTTGAGATGACCGCTCTGTAGGCAGCTCAAATAGCA
CTCCAGGAGCTCCGTGCTGCCCGAGGTCGGTGTGTGACCCGCAGGACCCACCCGTGGCTTCGGCCCATCTCAGTCCTGCAGAAGTTGCTTTGTTCTCCCTTGCAGCATTAAGAAGAACCT
GGAGAACGATGCCTTGAACCCCATAGAGCTCCTGAGGTACTTCAAGCAGCCCGTGGCGGGGACGCGGGCTGCCATCCGGGCTGCGGATTACATGGGAACCACCCTGACCCTCCTGAAGGA
GAAGCTGAGCCGGGTCGTGAAAGGGGACTTCAATGTCACAG
GTCGGGACGTCGCTGTGCCGGGAGCGGTGCTGTTGCGGGGAGATGCGGGGATCTGTGGGGCGCGGGGGGGCAGAGAGGG
AGGGGCTGAGGGGGTCCGGGCTCCCATCCCGCTCACCCCACCTGAGCGCCCCGTGCCGTGCTGAGGAGCGCTGTCCCCGGGAGGTGGCAGTCCTGCCCTCCTGCGGGAGCACTCGCAGTG
CGGTGGTGATGCATTCTGGAGGCGGCTTCCATAGGGGAAGAATTGTTAAGGCTTGGCTGGCTGTAACCGCTATATCAGTGGTGGAGATAATAGGAGGAAGAGAGGAAAGGAAGAAGATGG
CTTAATGCTAGAGGCTCATTCCTCTTCTGCACAAGCTCGGCATGTAATTATATGTCAGATTTGACCATAACTTTGTTAGTTTAAATGCTTTCATAGTATCATAGAATCACCAAGGTTGGA
AAAGAGCTCTAAGATCATCCGTCCAACCGTCCACCCATCACCAATATTTCCCACTAAACCACATCCCTCAGTACAACACGTAAACCTTTCTTGAGCACAAATGGTCAATGATACAATAGA
AGTGCAAACTGCCACTCCAGGGAGCATCCCCAGCACAGCTCTGAGCAGGATGACCCTAAATGACATTCCCCTGTGCTCCTCCACAAGAGATAAAAGATGTGCCAAGGGGACAAGAAGGGA
AACCTTTTCCTGATCTGGGAGACGACCCAAACCCAACGGAGCCGGTATGTGCCAACACACTGATCCCACGTGGTTACCTTGCAGACATGCTCACACCAGCTCAGATGGGGCTGCTTTTCA
AGGTGACAGGATGTGAGGAGCAGAATAAGAAAGTGAACTGTGAATTTTCTAGCCGGTACCGAACAATCACAGGGAAGTGCAACAACAG
GTGAGGGGGGATGCGTGGGTCATCAGTAGAAG
CAAAACCATGGCCCCAAAAATGATCCATGTATAGGATGCCTTATTTAGTTTTACAGCTCACGGAGTTGGTTCCTGGATGCTTGGATATTTTAATTACAGCTTTGTTTCACGGCTTCTTGG
TGTCATATGTGAATGAGCTAGCTGGCCTTTTGGCCAACAGTTCTGTGTTGGGAACTGACCCTTCAGCATAGGATCTCTGTCATCAGACTGCATCTTTCTGCTTTCTCCTGGGTTTTGGCT
AGCTCTTCCCCTTTGCAGGGTGTCAGTGCTCTTTTGGGCTTCCTGGCTGGGTACATGATGTGAGCACACCAGAACCCAACTGGGCCACTGGACTCATGGGCTGGCAAGACTACCTTGTGC
AGCTTTGGGGTATATGGAGGGATGTGACTTACACGGAACGTAAAAGCTATTTCTCAGCCCTTCCAGAATTTTCTCAGTGTAGTAAAGGGAAAACTGCCAGACAGTGGTGTGTTTTCAAAT
GAACAACATGTGAGAGTTGTCCATCCCTCCCCATTTACCAAGCACCTGTCAGGCAGAGCGTGTCCTGGCAGCTGTGGCCATAAGGTCCCTTGGGAGGAAGAAGGAGGTCAGATGGGATGA
TCATTCTCTGCCTGCCCAAGGGATGAGTGAGCCTTCAGTCCGTGTAAGAAGTAGGGAGAGGGCCACCTGTCTCCTTCCATTCTCAGAAGGTGATGGCTGCAGTCAGGAGGAGGGTCCAGA
TTCTGGGATAATGATGGGTCCATCACACCCGAGCCAGACCTGATGCCACTAATATTTTGCTGTCCTTTCATTTGCTGGTGCAGGAGAAACCCATTACTAGGAGCTTCCAACAGAGCCTTG
GCCAGATGGTTGCCAGCAGACTATGAAGACGGTGTGTCGATCCCCCACGGGTGGACAAACAGAAGGTGTTCCTTTGGATACCCTTTCCCACTG
GTAATATTTGGAGCACATCTGAAAAAA
AAACAGGGACAGGATTTAGGGATTTTCGGGGCTTGAACAGATTGCAGGCTGAGGTTGCAAAACACAAGTCCAGCAATGCATGCCTCATGATTTTATGCTGATGATCTTGCAGATGCATCC
ATTCCTATGGGCGTTTTCTGACACACGCGTTCTGCCTTCATCCCCCGCAGGTTCGAAGGGTGTCAAACGAGATCGTCCGCTTCCCCCCTGGGCAGCTCAAGTTTGACCAGCAGCGGTCGC
TCATGTTCATGCAGTGGGGTCAGTTTATTGACCACGATCTGGATTTCAGTCCTGAATCCCCAGCCAGAGTCACCTTCAATGGCAGAGTGGACTGTCACACCAGCTGCGCCAAGCTGCCCC
CCTGCTTTCCCATCCAG
GTACAGCCAACCTTCTCTGTCCCCCACGTCACCAGCCAGCCTGGTGATGTGGGGAACAGGGTGTCTGCCCTCCAGCTGGAGATGGTGACAGCTCTTCCTGTCC
CTGCCTACCAGGGCGCAGCTCCTAGAGCATCCCAATGGGTTGGACTGCTCTCAGGTGGTGCTGCTGAGTCCTGGGGATGCCCCCAGATGCCAGACATAGCCCATCTTTCCCCCCCTTTTC
AGCCTTGAACCACATCTCCTTCAAGGACACGGCTTTGCTTCAGAGGTGCAATGCAATGGCAACATGGATGGTACCCAGCTTACAGCAAATGGATCAGAGATGAGAGTTAGTGGGTGCTAG
TGTCTCATTGGTAGCCCAGAAAATCCATGCCCATCTGATGGTTGACTGCTTATGGGGTGAGAAAGTGGTGAGCACCTCTCACTAGTGGCTAAGCATTGTGCTGGAAAACACAACAGTCAT
GTTGCAATCTCTGCTCTAGTAAATACATCCAAGGAAGGGATAAGACTTCATCGAGTATTTGCCCAGTGCATGTTTGAGAATGCAGCCAGCACCACAAGTTCTGGATGGCGGCTGTCCAGA
ACATAGGGTAGATGTTGACACTAGACCACAACGTGAGATGGGAACACATGGGCTTCTTGGGTTTCATCCAATATGTACTTTCAAGGGAAAAAAGGGGAGGTATCCATAGGACTTTCTTTG
AGAAGATTCAGGCACCTGTAGTCTTTCTTGAATATTTAGGACTTGATCTCCAAAACCCATCTCTGCTGTCGGTCTGAGCCCTTACAGCTGGGACTTGGGACTGGTCTCCATACTGCCTAC
CATGAAAACTCTCTGAAATCGCTCCTGTTGGCTTTTCTTGTGGCTGTAGCACCACAGTGCAGGTTCTGAGCTCCTGAGGTGACGATGAATTATTCACTTATCTTTCTGCAGATCCCACCC
AACGACCCAAGGATTAAAAACACAAGAGATTGCATTCCTTTCTTCCGCTCAGCTCCTGCTTGTGACAGCGGAAGAGCCACTCGAGAGCAGATCAACGCGCTCACATCCTTCCTCGATGGC
AGTATGGTGTATGGCAGTGAACAGCATTTGGCCAACAGGCTGAGGAATTGGAACAACCAGCTGGGCTTGTTGGCTGTTAATCAGAATTTCACAGACAATGGGATGGCATATTTGCCCTTT
GTCAGGATGTCAAAGGACCCCTGTCTCAAGGTCAGCGGGAGTGCAAATATCCCTTGCTTTTTGGCAG
GTAAGTTGGCTGCTGACACCCTGGTAAATTCCATAGAGAACAATTCCATCGGC
TCTGTTTTTTTTCTTTGCTTGCTTGCTTGTTGTATTTAAGTAGAAAATAGCAGAACGAGGTGACCTCAGCACTGACAGCATGCTGTATGGGACATCAGCACAGGCTGTTATCCATTGGCA
GGGCCTTCTGCTCCATTCACACTTTGACATCCTCTTGAGCACTTTTTCACCTCAGGCTAACATGACATGAATCATGATTCATGATTCTTTGTTAAAAAAAATTAAGATCCAGTGGCAAGC
TATGGCAAGAGTGGTTTTGGCAAGGACTAAACTTTGTTGCACAGCTACAACTCAAAACTGAAGTATCATAGAGTCATTAGGGCTGGAAAAGACTTCTCAGATCCCCAAGTCCAACCCCAG
CCCACCCCACCATGCCCATAACCACGTCCCTCAGTGCCACATCCCCATGTCTCTGCAACACCTGCAGGGATGGTGACCCCACCACTCCCTGGGCAGCTGTGCCACTGCAGTACTGCTCTT
TTGGAGAAAAACTTTTCTTAATATCCAACCTAAGTAATATTTCAGTGCTTTAGGCCTTTCAGACTACGTTCCTGAATGGGCCTTATAAATTTATAGACAGAAATCAGCTGGAGATGAATT
TACAAACTCACAGCTCCATGCAGACTCCATTGAAAATTCAGTGTTTGGGTCTTTCCGGTCCCTGGGAGCTGAGGAAGTGGTCCATGTGCTGCTGCCCAACAGGGCCGAGTGATTTCGGAC
TGGAGCTCCTTTGGCAGTGCCGGGTGGGTGCCGTCTGCTGGAAGAGCCACAGTGCTCGTTTTGTCCGTCCTTCCGCAGCCTCTCACAGCCAGGCTTTGATCGTTAGTGAAAGGGGCTCTG
TGCTGAATGCGTGAGCAAATCCCTCTGTTCACTGCGGAACTAAATGCCACACATTTACTCCTCTCTGAGTGCCCCTTTATTCCATCATCACCTGCTCGCTCTCAGGTTTCCTGCCCTGGG
TGTTTGAAGTTGGACTTAATATTTCATCGTGATGCTTTTGCAACTTACTCCTTCAAGTTGTGAGTCATTTTGCTTTTATTTTAACTTTCCAAAGAGCTTGACTGTGACTGCCCTCTTGCT
TAGTCCATGGTTTCAGCTGATTTGAAGGACAACTTCCGACCTACAGACCTCCCTTGGCCATCTAGACATCCCTCTGCCCATTTTCACTTCTTTCTTGAGCTGTGAGTCTCTCTGCTACGG
GAGCCTGAAGGAGGACTCCACGTAGTGAACTCCTCAAGTGTCCCTTCCTAGCCTCCAAAACAAAAAGCTTCCCCATTTCTTGTCCATCTCTCTTTGTGATGCTCGGTACAACCATGCTTG
ACTTGAATCAATAGTCAAGACAATACTGCTTCAGCAGGAAATGGCTTTCCACGGGACCTCCGCAGCCCTTGAGCAGTACAAGTAAGTGCACTTGTGATGCCCTTAGGTGACTCTAGAGCA
AGCGAGATGCTGGAGCTGGCATGCATGCACACACTCTTTGTGAGGGAGCACAACCGCCTGGCCATAGGGCTGAAGAGATTGAATCCGCACTGGAATGGGGAGAGGATCTACCAGGAGGCA
CGGAAGATTGTGGGTGCAATGATCCAG
GTACCACCATGTCACCCCCCAGCTCTGCTGCCTTGTCCTGTGGTCTCACAGTTATCCTGGTGGGCTTTGTCAGCAAGAGGTTTCCATTGGGTG
GTGGGTTTTTTTGAGTTGCATTTTTCAGCCTCCTCATTAATATCCCAAAGACACATGAAATCAGGGCTGGAAACCTCTGCTGTATGGACTAACACAACTGCCCACAGGAGTTTATATGAT
CTGTGTCAGCACCATAGATGTGAGCAGCAGATCTCCCATTACTTTGTTGACTAGGAACTTGATGATTAAGCAATTAATCATTCACACTTTCTCGGTTTCCCTTTAGATTATAACCTACAG
GGACTACTTGCCTCTTCTCCTGGGAAGAAATTTACAGAGATGGATTCCTTCCTACAAGGGCTACAAGGAGTCAGTGGATCCTCGCATATCCAATGTCTTCACTCTGGCTTTTCGTTTTGC
TCATGCTTCAATTCCCCCATCTGTGGGCCGATTAAACCAAAATTATCAGTCCACATATCCCAAGTTGAAATTGAGCAAAACCTTTTTTGGTGTTTGGCATATTGTGAAAGGAG
GTAAGTC
CTATGTTGGAATCATTGAAATCACAGGGTCGTTGAGGTTGGAAAAAACCTCTAAGATCATCCAGTCCATCTGCCAACTACTGCCAACATTGTCCACTTACTCATGTGAGCCATCTTGCAC
TTCTGGGGTGTAACTTTATTTTGTTAAGCCTTTCCAGCCCACACTGGATGAGCTCCTGCTTCATCCAAACTTAAAAGCAATTTGCATTAGATGTATTCACTCACCTTTATCACCAGGCAG
ACTTTTCCCAACACAGCTGTTCTCTGCAGTCAAATGCCACCCATCTTATTATGACGTATGCAACCTGATTGTTTAATTGCTGTAGTTTTTAATAACTACAGTTTTTTCTTTTTAATGCTT
TATGTGCAGGAAAATCGATTCTCCTGCACTGGAATCCCGTAATGAGCTATAAGCCATGCTCTGCTCTCTGGAACCTTTTTCCCATGTGCTTTCCATCCTACCTTGCTCAACAGCTGCTGT
GAATCCATTGCAGGTGGCATTGACCCCTTCCTGCGGAACCTGATGGCCAGCAAGGCCAAGCTGATGACACAGGATCAGATGATGGTGGATGAGCTCCGGGATCACCTCTCTGAGCAGATA
GAAAGGATTGGGCTTGATTTAGCTGCTCTTAACATGCAGCGTGGCAGAGACCATGGCCTCCCAG
GTAAGTTGGCTGTAGCATCAGAGCTTCCAAAGGAAAACAAGTGAAAATCAGGCACT
CATGGAATTGAACACTGGGAAACATCTCCAGCCTGTGCTTGGCTGAAACTCCTCAGAAAAGCACAGTGCACGACATAAAAAAGAAAATCTCACTCTATTTTCTCTCCAAAGACTGTGTCC
CAGAAAGAAAAAGAAAAAAAAAAAAGAGAGAGAGAGAAAGGCATGTCAAAGCCACTCATGGGACTCTGCAACACGAAAAACCAGTGTGATGGCATTGCATGATGGTCTTGAGAAACAGGT
TGTTGATCCAACTGGATCAAGGGTGTGCTGTTGCCTAACAGTGTTATTAGGCTGATGCAAGTGCCTGCAACTGCTGTGCCACTGACACCCTGGGAGCTGCAATGTGGTTCACTTTGAAAC
AGTGATGAGGAGCTCCGGATTCACAGGTTTTAAGTCAAGACAGAGGCTTTGCATGAGATGCAGATGTGTGGTCAGGTTTTGCTGGGATTGCTCTGCCTCTCTCTCAATGGGACGTTTTGA
TTTTCCATGCTGCCTCTGGGAACATTGGTGTGCAGAATCCTGAATTTCTAGTTTTTGGGTCTGGCAGGAAGGAGAACGCATGAGTTCTCTGTAGGCTTTTCCTTTCCTTAAGCAGTCATT
TGGTAAAACACAGAGAGAACTGAGCTGTACGCTGACTTCTGCCGTCTATGTGCCCTGTCCATCAGGATGCAGTTATTCTGCCAGTTGAGGTCTAGCAAATTTCCATCTATTTGCTGCACG
CAAAAATGGGCCAGTTGACAACATCCAGTGTTCCTCTTCCACCTGTAGAAACCGGCTCTGGAGCAGGGAAAGGCAATGGCATTAACAGCAATACAGAATAGTTTAGAAAGAATATTTAAG
CACAAGTAGGAACCTACCTGTGTCCAGACTTCGGGAAAGGGGGGAAAAATCTTTCCAGGGAGGGGAAGTGTTGCTGACCTGTCTTTGCTCTGATATGCAACAACTTGCAGGTTATGTCTC
CTGGAGAAAATTCTGTGGGCTCCCCCAGCCTTATGATGTGAGGTCACTTGGTCAAGTATTGAAGAATAAGAATCTCGCAAGGAAGTTCATGAAGCTGTATGGGACACCGAGGAACATTGA
CATTTGGGTTGGGGCACTTGCAGAGCCTTTTGTGGATGGAGGAAGGGTTGGGCCTCTCATGGCTTGTCTCATTGGCACGCAGTTCAGGAACACACGTGATGGGGACAG
GTAAGAGAGGAG
ATGTCCAGTGTCTGCTGATGCAGTGGTGAATGCTTTGAATAGCTGGAAGATTTGCCTTGGGAAAAAAATATGTTGGTTTTAATGGGAAATAATGTTGCTAGGATCTTGAATGAGAAAAAG
CCAAGAGGGAAAAAAATCTATTGTGCCATTCATTATGTCTCCTGCAGGTTTTGGTGGGAGAATACAGGAGTATTCACTGCCCAGCAGCGCAGTTCACTGGCCAAAATCTCCTTGTCACGA
ATAATATGTGACAACACCCACATCACTAAAGTGTCAAGAAATATCTTCCAGGCCAACAGCTATCCTCACTCCTTTGTGAGCTGCAGCAGTATCCCAAAGCTGGACCTCAGAGCCTGGAAG
TCAAATTGTATGGAAGAAAGTACGGAGCAAG
GTATCAGCCTCAAAGAGCAGACAGTTTCTGCCTGCAAGCAAGTATAAATCTCTGCAATCATTAACAGCTCAGACAATCCCAGCTGAGCT
CTGCTCCCATTTCCCTTGAGGATGTTAAGTCACGTTCTCCACAGGGCTGTGGCAGTATCAGATTGAAGGTGTGAGAAGGTGCCTCCATAAATGCCACCCTCATAGGGCCAGAAGAAGTAG
GGTTTGTTGGGCTGCAGGCAGCTGTCAGCAGGGAGGGATGTCCAGAGCATTCTCCTGCTCAGTGCGAGGGCAACGCCTGAGCTGTTGGGCCCTCCTTTCCAGCTTAACCCATGGAAATGA
ATCACACAAGACAGCGGGGAGCCATGGCATGCCCTTTTCTGCTTTGTTAACACATGTTTTTTTATGTCCTGCAGAAGAAACACCTGGTGACCAATAA

Retrieve as FASTA