Entry information : TaPrx112-1A (TAPOX2 / TaPrx02-1A)
Entry ID 41
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-18 (Christophe Dunand)
Peroxidase information: TaPrx112-1A (TAPOX2 / TaPrx02-1A)
Name (synonym) TaPrx112-1A (TAPOX2 / TaPrx02-1A)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Triticum
Organism Triticum aestivum (bread wheat)    [TaxId: 4565 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaPrx112-1A
start..stop
S start..stop
TmPrx03 634 0 1..314 1..314
AvePrx112-1M 634 0 1..314 1..314
TaPrx112-1B 623 0 1..314 1..314
AvePrx112-1C 593 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 212..421 210 N° 2 529..705 177 N° 3 849..1406 558  
join(212..421,529..705,849..1406)


exon

Literature and cross-references TaPrx112-1A (TAPOX2 / TaPrx02-1A)
Literature Baga,M., Chibbar,R.N. and Kartha,K.K. Molecular cloning and expression analysis of peroxidase genes from wheat. Plant Mol. Biol. 29 (4), 647-662 (1995)
Protein ref. UniProtKB:   Q43218
DNA ref. GenBank:   X85228.1
Protein sequence: TaPrx112-1A (TAPOX2 / TaPrx02-1A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (291)
PWM (Da):   %s   32570.21 (30413.0)  
PI (pH):   %s   8.21 (7.99) Peptide Signal:   %s   cut: 24 range:24-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMGSASRISLVVLVALATAASGQLSSTFYDTSCPRALATIKSGVAAAVSSDPRMGASLLRLHFHDCFVQGCDASVLLSGMEQNAGPNVGSLRGFGVIDNIKTQLESICKQTVSCADILTVAARDSVVALGGPSWTVPLGRRDSTTASASLANSDLPGPSSSRSQLEAAFLKKNLNTVDMVALSGAHTIGKAQCSNFRTRIYGGDTNINTAFATSLKANCPQSGGNTNLENLDTTTPNAFDNAYYTNLLSQKGLLHSDQVLFNNDTTDNTVRNFASNAAAFSSAFTTAMIKMGNIAPLTGTQGQIRLSCSKVNS*

Retrieve as FASTA  
Remarks genomic and control of expression. UniGene Ta.5385
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCCTCTCGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCGTCCGGGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAA
GCAAGTTTCACATAATATATCAGCTCTTTT
TCCCTTAACCAACTTTCTTGAACTCCCGGATTTAACAAAATTTATATTCCGACCTAATACGTTTATGTTGGCTACAGGGCTGTGACGCATCTGTTCTTCTGTCTGGCATGGAACAAAACG
CGGGTCCGAACGTGGGGTCGCTGAGGGGCTTCGGCGTCATCGACAACATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCGCCGCCCGCG
ACTCCGTTGTCGCT
GTAAGAACATCTTAGTACTACACTCATTTACATGATCGATGCTACCTGAAGGATAGAACATATATCCCCTCCGATTCATATAAATTGTCGCTGATTTAGTACATAC
TTAATTTCCTACTTGGTCTGCTATCTTTCACATACAGCTTGGAGGGCCATCGTGGACTGTCCCGCTGGGGAGACGGGACTCCACCACCGCAAGTGCCTCGCTGGCGAACAGTGACCTCCC
TGGCCCGAGCTCTAGCCGGTCACAGCTCGAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTT
CCGGACTCGGATCTACGGCGGTGACACCAACATCAACACTGCCTTCGCGACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACACCAACCTGGAGAACCTGGACACGACGACGCC
CAACGCGTTCGACAACGCCTACTACACCAACCTCCTGTCACAGAAAGGGCTCCTGCACTCGGACCAGGTGCTCTTCAACAACGACACCACCGACAACACTGTCCGCAACTTTGCGTCCAA
CGCGGCGGCCTTCAGCAGCGCCTTCACGACGGCCATGATCAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCCTCTCGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCGTCCGGGCAGCTGTCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAA
GGCTGTGACGCATCTGTTCTTCTGTCTGGC
ATGGAACAAAACGCGGGTCCGAACGTGGGGTCGCTGAGGGGCTTCGGCGTCATCGACAACATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACC
GTCGCCGCCCGCGACTCCGTTGTCGCT
CTTGGAGGGCCATCGTGGACTGTCCCGCTGGGGAGACGGGACTCCACCACCGCAAGTGCCTCGCTGGCGAACAGTGACCTCCCTGGCCCGAGC
TCTAGCCGGTCACAGCTCGAGGCCGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTTCCGGACTCGG
ATCTACGGCGGTGACACCAACATCAACACTGCCTTCGCGACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACACCAACCTGGAGAACCTGGACACGACGACGCCCAACGCGTTC
GACAACGCCTACTACACCAACCTCCTGTCACAGAAAGGGCTCCTGCACTCGGACCAGGTGCTCTTCAACAACGACACCACCGACAACACTGTCCGCAACTTTGCGTCCAACGCGGCGGCC
TTCAGCAGCGCCTTCACGACGGCCATGATCAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA