Entry information : MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Entry ID 410
Creation 2006-02-17 (Christophe Dunand)
Last sequence changes 2006-02-17
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Name (synonym) MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Mycorrhizal roots
Seedling roots
Inducers Glomus intraradices infection
Mycorrhiza
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx58
start..stop
S start..stop
MtPrx52 633 0 1..326 1..326
LjPrx36 574 0 1..326 1..326
GmPrx203 546 0 1..326 1..327
GmPrx103 544 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6609744..6609959 216 N° 2 6609430..6609621 192 N° 3 6609127..6609289 163 N° 4 6608392..6608801 410
complement(join(6608392..6608801,6609127..6609289,6609430..6609621,6609744..6609 959))


exon

Literature and cross-references MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Literature VandenBosch,K. et al., unpublished.
DNA ref. Phytozome 11:   chr5 (6609959..6608392)
EST ref. GenBank:   EY475946 [5' end]
Cluster/Prediction ref. Phytozome Gene 11:   31088894 UniGene:   Mtr.10147 [3' end]
Omic ref. Gene atlas:   Mtr.42063.1.S1_at Legoo:   Mtr.42063.1.S1_at
Protein sequence: MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   35927.02 (33051.7) Transmb domain:   %s   o10-32i
PI (pH):   %s   7.24 (7.24) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MECVSNKHVFVFMFCLVFLTPNVCSQLYYNFYIRTCPNLNRIVKNNILSAIANDSRIAASLLRLHFHDCFVNGCEGSVLLDDTDTLKGEKNALPNKNSLRGFDIIDKIKSDLEYACPNTVSCADILTLAARDAVYQSRGPFWAVPLGRRDGTTASESEANNLPSPFEPLENITAKFISKGLEKKDVAVLSGAHTFGFAQCFTFKPRLFDFGGSGKSDPSLDSSLLQNLQRVCPNQADSDTNLAPLDPVTSNTFDNTYYRNVLSNSGLLQSDQALLGDSTTASLVNYYSKWPILFFRDFAVSVEKMGRIGVLTGQQGQIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 5 ESTs (EY475946, AJ504367, BM779946, BM779808, AW257483). In tandem with Prx ID 375.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTGTTTTCATGTTTTGTCTTGTGTTTCTTACTCCAAATGTGTGCTCTCAACTCTATTACAACTTCTACATTAGAACTTGTCCAAACCTGAAC
AGAATTGTTAAAAATAATATCTTGTCAGCTATAGCTAATGACTCAAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCAAT
GTAATTAAGTCTCTTCATTTCCAT
TATTTTTTACACTGTCAATTAATATACCGTTGGATCGTTAAAATTATTCTTTAATAATATTATGTGTTGATTTGTTATTTCATTTTTGTGTTACATAGGGATGTGAAGGATCTGTGCTAC
TGGATGATACAGACACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCATTAAGAGGATTTGATATAATTGACAAAATAAAGTCTGATTTAGAGTATGCTTGTCCCAACACAG
TGTCATGTGCTGATATACTTACTCTAGCAGCCAGAGATGCTGTATATCAA
GTAAGAACTCACTACTTTATAACTATTTGAATAAGTTTGAAGAAGCTGATTCAATATATCATGCATGAGC
AATAACATTTTAATTACTGCATGTTTCCAACATATTGTTACTTAAAATTTTTGTATTTTTTCTTTTCCAGAGTAGAGGTCCATTTTGGGCTGTGCCTCTTGGTCGTAGAGATGGCACAAC
CGCGAGTGAGAGTGAGGCAAATAACTTGCCATCACCCTTTGAACCTCTTGAAAATATTACTGCTAAGTTCATTTCCAAAGGTCTTGAAAAGAAGGATGTAGCAGTGCTCTCAG
GTTTACT
TCCTTCACAATTATTTGTATGAAAATGTTTGTAACATAACATGAACAACATATAAAACCCATTAGAGTTGGCCTAGTAAAAGAAAACAATGAATAGCAAATATATGTCTCATATAATTTT
ATCTGATAAGGTCATCAAAACATTTCTCTATTAATGTTTAAATCCTTAACTCCAAAAGTTTGGGCTAGTAGTAAAAAGACATACCTTAAATCCTTAAAATTTCATTGAATCTGAAAAAAA
AGAATTTTTACATATGAGACCGAATGGATTACTAGTTAGTGAAGCGACCGATTTCACGCGTGTATTAACTATATACAGGTGCACACACCTTCGGGTTTGCTCAATGCTTTACATTCAAGC
CAAGACTATTCGACTTTGGTGGCTCGGGTAAATCTGATCCATCACTTGATTCATCACTTCTACAAAACTTACAAAGAGTATGTCCAAATCAAGCTGATTCCGACACCAATTTAGCTCCAT
TGGATCCTGTCACAAGCAACACATTTGACAACACATATTACAGGAATGTTTTGAGCAATTCTGGACTACTTCAATCAGACCAAGCTCTTTTGGGTGACAGCACAACTGCTTCATTGGTTA
ACTATTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGCCGCATTGGTGTTTTGACGGGACAACAGGGTCAAATAAGGAAAAATTGTAGGGTTG
TTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTGTTTTCATGTTTTGTCTTGTGTTTCTTACTCCAAATGTGTGCTCTCAACTCTATTACAACTTCTACATTAGAACTTGTCCAAACCTGAAC
AGAATTGTTAAAAATAATATCTTGTCAGCTATAGCTAATGACTCAAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCAAT
GGATGTGAAGGATCTGTGCTACTG
GATGATACAGACACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCATTAAGAGGATTTGATATAATTGACAAAATAAAGTCTGATTTAGAGTATGCTTGTCCCAACACAGTG
TCATGTGCTGATATACTTACTCTAGCAGCCAGAGATGCTGTATATCAA
AGTAGAGGTCCATTTTGGGCTGTGCCTCTTGGTCGTAGAGATGGCACAACCGCGAGTGAGAGTGAGGCAAAT
AACTTGCCATCACCCTTTGAACCTCTTGAAAATATTACTGCTAAGTTCATTTCCAAAGGTCTTGAAAAGAAGGATGTAGCAGTGCTCTCAG
GTGCACACACCTTCGGGTTTGCTCAATGC
TTTACATTCAAGCCAAGACTATTCGACTTTGGTGGCTCGGGTAAATCTGATCCATCACTTGATTCATCACTTCTACAAAACTTACAAAGAGTATGTCCAAATCAAGCTGATTCCGACACC
AATTTAGCTCCATTGGATCCTGTCACAAGCAACACATTTGACAACACATATTACAGGAATGTTTTGAGCAATTCTGGACTACTTCAATCAGACCAAGCTCTTTTGGGTGACAGCACAACT
GCTTCATTGGTTAACTATTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGCCGCATTGGTGTTTTGACGGGACAACAGGGTCAAATAAGGAAA
AATTGTAGGGTTGTTAACTAG

Retrieve as FASTA