Entry information : MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Entry ID 410
Creation 2006-02-17 (Christophe Dunand)
Last sequence changes 2006-02-17
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-29 (Messaoudi)
Peroxidase information: MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Name (synonym) MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Mycorrhizal roots
Seedling roots
Inducers Glomus intraradices infection
Mycorrhiza
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx58
start..stop
S start..stop
MtPrx52 633 0 1..326 1..326
LjPrx36 574 0 1..326 1..326
GmPrx203 546 0 1..326 1..327
GmPrx103 544 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6609744..6609959 216 N° 2 6609430..6609621 192 N° 3 6609127..6609289 163 N° 4 6608392..6608801 410
complement(join(6608392..6608801,6609127..6609289,6609430..6609621,6609744..6609 959))


exon

Literature and cross-references MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Literature VandenBosch,K. et al., unpublished.
DNA ref. Phytozome 11:   chr5 (6609959..6608392)
EST ref. GenBank:   EY475946 [5' end]
Cluster/Prediction ref. Phytozome Gene 11:   31088894 UniGene:   Mtr.10147 [3' end]
Omic ref. Gene atlas:   Mtr.42063.1.S1_at Legoo:   Mtr.42063.1.S1_at
Protein sequence: MtPrx58 (Medtr5g017860.1[4.0] / Medtr5g017860.1[3.5] / Medtr5g017870.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 326 (301)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
35927.02 (33051.7) Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
o10-32i
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.24 (7.24) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MECVSNKHVFVFMFCLVFLTPNVCSQLYYNFYIRTCPNLNRIVKNNILSAIANDSRIAASLLRLHFHDCFVNGCEGSVLLDDTDTLKGEKNALPNKNSLRGFDIIDKIKSDLEYACPNTVSCADILTLAARDAVYQSRGPFWAVPLGRRDGTTASESEANNLPSPFEPLENITAKFISKGLEKKDVAVLSGAHTFGFAQCFTFKPRLFDFGGSGKSDPSLDSSLLQNLQRVCPNQADSDTNLAPLDPVTSNTFDNTYYRNVLSNSGLLQSDQALLGDSTTASLVNYYSKWPILFFRDFAVSVEKMGRIGVLTGQQGQIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 5 ESTs (EY475946, AJ504367, BM779946, BM779808, AW257483). In tandem with Prx ID 375.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTGTTTTCATGTTTTGTCTTGTGTTTCTTACTCCAAATGTGTGCTCTCAACTCTATTACAACTTCTACATTAGAACTTGTCCAAACCTGAAC
AGAATTGTTAAAAATAATATCTTGTCAGCTATAGCTAATGACTCAAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCAAT
GTAATTAAGTCTCTTCATTTCCAT
TATTTTTTACACTGTCAATTAATATACCGTTGGATCGTTAAAATTATTCTTTAATAATATTATGTGTTGATTTGTTATTTCATTTTTGTGTTACATAGGGATGTGAAGGATCTGTGCTAC
TGGATGATACAGACACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCATTAAGAGGATTTGATATAATTGACAAAATAAAGTCTGATTTAGAGTATGCTTGTCCCAACACAG
TGTCATGTGCTGATATACTTACTCTAGCAGCCAGAGATGCTGTATATCAA
GTAAGAACTCACTACTTTATAACTATTTGAATAAGTTTGAAGAAGCTGATTCAATATATCATGCATGAGC
AATAACATTTTAATTACTGCATGTTTCCAACATATTGTTACTTAAAATTTTTGTATTTTTTCTTTTCCAGAGTAGAGGTCCATTTTGGGCTGTGCCTCTTGGTCGTAGAGATGGCACAAC
CGCGAGTGAGAGTGAGGCAAATAACTTGCCATCACCCTTTGAACCTCTTGAAAATATTACTGCTAAGTTCATTTCCAAAGGTCTTGAAAAGAAGGATGTAGCAGTGCTCTCAG
GTTTACT
TCCTTCACAATTATTTGTATGAAAATGTTTGTAACATAACATGAACAACATATAAAACCCATTAGAGTTGGCCTAGTAAAAGAAAACAATGAATAGCAAATATATGTCTCATATAATTTT
ATCTGATAAGGTCATCAAAACATTTCTCTATTAATGTTTAAATCCTTAACTCCAAAAGTTTGGGCTAGTAGTAAAAAGACATACCTTAAATCCTTAAAATTTCATTGAATCTGAAAAAAA
AGAATTTTTACATATGAGACCGAATGGATTACTAGTTAGTGAAGCGACCGATTTCACGCGTGTATTAACTATATACAGGTGCACACACCTTCGGGTTTGCTCAATGCTTTACATTCAAGC
CAAGACTATTCGACTTTGGTGGCTCGGGTAAATCTGATCCATCACTTGATTCATCACTTCTACAAAACTTACAAAGAGTATGTCCAAATCAAGCTGATTCCGACACCAATTTAGCTCCAT
TGGATCCTGTCACAAGCAACACATTTGACAACACATATTACAGGAATGTTTTGAGCAATTCTGGACTACTTCAATCAGACCAAGCTCTTTTGGGTGACAGCACAACTGCTTCATTGGTTA
ACTATTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGCCGCATTGGTGTTTTGACGGGACAACAGGGTCAAATAAGGAAAAATTGTAGGGTTG
TTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGTGTCTCTAACAAACATGTTTTTGTTTTCATGTTTTGTCTTGTGTTTCTTACTCCAAATGTGTGCTCTCAACTCTATTACAACTTCTACATTAGAACTTGTCCAAACCTGAAC
AGAATTGTTAAAAATAATATCTTGTCAGCTATAGCTAATGACTCAAGGATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCAAT
GGATGTGAAGGATCTGTGCTACTG
GATGATACAGACACACTAAAAGGGGAGAAAAATGCACTTCCTAATAAAAATTCATTAAGAGGATTTGATATAATTGACAAAATAAAGTCTGATTTAGAGTATGCTTGTCCCAACACAGTG
TCATGTGCTGATATACTTACTCTAGCAGCCAGAGATGCTGTATATCAA
AGTAGAGGTCCATTTTGGGCTGTGCCTCTTGGTCGTAGAGATGGCACAACCGCGAGTGAGAGTGAGGCAAAT
AACTTGCCATCACCCTTTGAACCTCTTGAAAATATTACTGCTAAGTTCATTTCCAAAGGTCTTGAAAAGAAGGATGTAGCAGTGCTCTCAG
GTGCACACACCTTCGGGTTTGCTCAATGC
TTTACATTCAAGCCAAGACTATTCGACTTTGGTGGCTCGGGTAAATCTGATCCATCACTTGATTCATCACTTCTACAAAACTTACAAAGAGTATGTCCAAATCAAGCTGATTCCGACACC
AATTTAGCTCCATTGGATCCTGTCACAAGCAACACATTTGACAACACATATTACAGGAATGTTTTGAGCAATTCTGGACTACTTCAATCAGACCAAGCTCTTTTGGGTGACAGCACAACT
GCTTCATTGGTTAACTATTATAGCAAGTGGCCTATTCTGTTTTTCAGAGATTTTGCGGTTTCTGTTGAGAAAATGGGCCGCATTGGTGTTTTGACGGGACAACAGGGTCAAATAAGGAAA
AATTGTAGGGTTGTTAACTAG

Retrieve as FASTA