Entry information : TcasPxd01
Entry ID 4102
Creation 2006-11-24 (Marcel Zamocky)
Last sequence changes 2016-01-20 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-20 (Achraf Jemmat)
Peroxidase information: TcasPxd01
Name TcasPxd01
Class Peroxidasin    [Orthogroup: Pxd001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Tenebrionidae Tribolium
Organism Tribolium castaneum    [TaxId: 7070 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TcasPxd01
start..stop
S start..stop
AaePxd 1439 0 13..1387 19..1432
DwiPxd01 1426 0 28..1312 32..1350
DmoPxd01 1407 0 1..1312 4..1394
DpePxd01 1406 0 28..1376 23..1387
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 181927..182102 176 N° 2 175973..176188 216 N° 3 175852..175923 72 N° 4 175573..175802 230
N° 5 175215..175520 306 N° 6 174882..175154 273 N° 7 169890..172783 2894  
complement(join(169890..172783,174882..175154,175215..175520,175573..175802,1758 52..175923,175973..176188,181927..182102))


exon

Literature and cross-references TcasPxd01
Literature Kim,H.S.,et al., BeetleBase in 2010: revisions to provide comprehensive genomic information for Tribolium castaneum. Nucleic Acids Res. 38 (DATABASE ISSUE), D437-D442 (2010)
DNA ref. GenBank:   86575519 (1..12213)
mRNA ref. GenBank:   XM_963477.2
Cluster/Prediction ref. Genebank:   656984
Protein sequence: TcasPxd01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1388 (1370)
PWM (Da):   %s   157344.19 (155271.0)  
PI (pH):   %s   7.84 (7.85) Peptide Signal:   %s   cut: 19 range:19-1388
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWRLCLIFLTLGLTIIDAQRRNYSQFPCPSRCVCFRRTVRCMQLELTEVPKAPLPTVMLDLRFNKIRDIVPGSFKGHKALRSLLLNNNSLKSLKNGIFTGLVQLRHLYLYKNRIKYIEDEVFHGLPKLEHLYLHNNELEEFKSGTFSNIPQLDRLFLYNNHISHIPAGAFQNLPKLTRLRLDQNALVCDCRIAWFAKMLNDNTIHVAANCRYPHEMYGKPLKGMTTRDFHKAPEIMEGPQDVEISWGSTAVFTCRVTGDPKPSIYWMRDDKEIEMNNDKYDIMDNGSLVIKHTDESDSGHYECMAKNEDGEVKSRPARMILVRPDQQFRGGNGSPVFLVTPVSVTTSESDPSVSLHCKAFGNPHPTITWSRNGIQLTTSQRHFIDEDGTLVIRPVKASDHGTYRCDATNSNGRISSEADVIVNVAPVFTVHPQNTETTPGSTIKLECFAVGSPPPEITWFKDDLEVRSDGRLSISPDGSSLQIHNAKETDSGLYICEARNHLGFREVSAKVKVTPLARKPPKFIYKPYNIEALVGSTIELPCKADGDPTPGIQWQKDGASLQRTGRTKVSLIGNLYIYGVVPDDQGRYECAAINDFGRSTASCYVTVKENQNPTDFGIGDKFVKIAFDEASHEVDKAINKTIDNLFHNKGPHSSADLFRLVRFPDAPARELARAAEVYERTLVNIRKHVERGMTMNASSNFNYREILSPDHLNLVAELSGCMTHRLARNCSDMCFHSKYRTIDGTCNNLQHPMWGASLTGFRRILKPIYENGFSTPVGWNKGVKYYGFPKPSSRLVSTTLIATKRTTPDGEITHMVMQWGQFLDHDLDHAIPSVSSESWDGIDCKKSCDYAAPCYPMDVPPNDPRVTNRRCIDFIRSSAICGSGMTSVFFDNIQHREQINQLTSYIDASQVYGFSEELARDLRDLNSDGGRLREGPIFPNRKPLLPYAGNQGVDCRRNLSESTINCFVAGDIRANEQAGLIAMHTLWMREHNRVARELKQLNPQWNSDTVYHESRKIIGAAMQHLTYQHWLRFIIGEEGMQLLGEYKGYDPTVNPSISNVFATAALRFGHTLINPVLHRLDWDFKPIREGHLPLHKAFFSPWRIVDEGGIDPLLRGLFTVPAKIKKPDENLNTALTEQLFETAHAVALDLAAMNIHRSRDHAIPGYIEFRKFCNMTQVDSFEDLTGEITDRSVLRKLQDLYGHPGNIDVWVGGVLEDPVKGGRVGPLFRCLLIEQFRRLRDGDRFYYENPSVFKPEQLVQIKQYSLSRVLCDNGDNITRVSKNAFVLPELQGGFSQCEEIPRVDLSVWSECCSDCRYSGQLNTISRLNARNRRHLDEGFANSTLKDGYFEENRKLKKRIVRMEKDLTSMKDTIQELERVIRKLEREN

Retrieve as FASTA  
Remarks Complete sequence from genomic and mRNA. Strain="Georgia GA2. Belongs to the peroxidasin clade of the peroxidase-cyclooxygenase superfamily. REGIONS: 240-316 IGcam, 336-422 IGcam, 427-512 IGcam, 522-607 IGcam, 738-1289 Animal HEME PEROXIDASE pfam03098.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGCGATTGTGTTTGATTTTTCTCACACTAGGACTCACCATCATTGACGCACAAAGACGGAATTATTCACAATTCCCTTGCCCTTCGAGATGTGTCTGCTTCAGGAGAACAGTGAGA
TGCATGCAACTGGAGCTGACCGAAGTCCCAAAAGCACCACTGCCCACAGTCATGCT
GTAAGTTGAATAAAATATTTGCTTTTTTTTTGGATGGAAATGAGACGTTAGATCATAGATAAAA
TTGTAATTGTAGAAATGTGCTACCCACTGGCATGCAAATGCCATTTCAAAAAAAGAAGCACAGTCACGTGCAAAACTTGTTGCAATTGCTCCGCGATTTTTTAAATTCAAGACGACCGTC
AAAACAAACAAGGGAGTGTACCTTATTATCTAAAAATATAAATACCTATATATTGATTATTGATAATTGCCTCAGACATGTTTGTTTTTATTTAAAGTGTGTTTAGACTGCAGACATTCA
TTGATCTCTTGTTAAAAAATGTCTTGCAGCCAACACACAAGGTCAATAAATCATTGGACCAAATCGCCCAAAAAATTAATTCAAAAATAAACTGAAACTCAATTTGTTGACTTTAGCCGG
ATCATGTGTAATATCTAATAAAAGTTTTCTTATATTAGAGATGAAAAGCATACCGGAATATTTTTAAATGTCTAAAAGCTACCTAAATTCCGATTTTTTCAAAAATGCTTACAAATGTGT
ACCATGCACATGTGATGAATTTCGAAATACCTCCCAGTTTGTGGCGACTGCAGATTATTTATTCATAAGAAGAGTTTAAAAAGTGAATGCCAGTAACCGCTTTCGTTGTTTTCACATTTT
TAAGATAACTTTTTGGTTTTTATCATTGCAAAGCCAAACATTGGGAGACTGTTTGCCAAATACCAAATTCATTGCAAGTGCAAATATTTGGAAATCTATTCGTGATCCTCCATTTTAATG
GACTGTATAATATAACATAACTCTTCAGTAATTTCGTGATTTCACTCACTTGCTTTATCTTGTCACTGACACATAAATAAATGCTTCAAATAATTAACTTTCTTCATAATGAACCTAAGG
CGTCATGCAAGAATTTCTCGTGTGATGGAAAATTGGAGTTTTTTTACTTTTTTGAGAGAACAATCAGTTATTTTAAAACGGCAAATGGGAATCAATCATAACTGCTTGGCAATAACCGTT
TTTTAAACATTCCGATTGCTTATCGAGTTATAAATAAAATAATAGCACAAACACATGTGCGACATAAATCTTGCGTCCGAAAATTATTGGAGAAAAACATGCATCTGCATAATTTTCATT
TAAAAAGTAACGGAACTCGAATATTGCAAAACTAGATCCAAGATCGTCTTTCATCATATGACAAAGCAGTTGTTGTTTTACTGATTTTGTTACGAAGCGTATCTTTGGTTTTAATGTCTC
TTGTTAAAAAATCGTTCTTAAAATAACGTCTAATTTAAAAATACAACCAGTGTTATTGAAGTTATTGGAAATGGAAAAGATTTAGCTGAAGTACCGAAATAGGCATGACGCTAACAATAT
TAATAACTGAATCCATTATCACGTTTTTACAACCATAAATGTCTCATCTTGTGATCACATCCATCAACCCATAGACATTACACTTCATTGGGTTCCTGGTAACTTGTGAACTGAAACATG
TAGGTAGGTAAGTTATTGTTATTACACCGAATGAATGCGAAATATTTGAATCGCAGCAGCCATGCCTTAATATCACATTTGTTAAACACAATTCACGAAAAAACATTAAAAAGCCCGTTG
TATTACTCAATCGGGTATAAAAAGTCAATAAAATGCAGGAAATCTCCGTCATGTGAGAGGATGTACCCAAATAAAATTTATTACCAAAGGCAAGGTTTCCGAGATTGTGGTGTCCCTTAT
AACTCCACCAACTCTATAATTGTGTTCATTCATATTATAATCTTGCTTAAATTGTATGCTGATCGCCTATTATAAATTCAGGCACAGTGATTTAAAATAATCTTGTTATGATAAGTAAGC
AATTGGTAGGCGAGCTGAGGAAAATCACAAAGGTATATTAATGTCAGTAGTTAAGTCCCAGGAGATCTGTCAAATATGTGTCAGGAGTTATAATATCACGACCCATGAATTGAAGATAAC
CTTTATGAATTCATGGAGCGTAAACTTTGATATATTGTCGTAAATATTTAAGCAGCAGGGTGTGGGCAGGAGACAAAAATTGGAAAAACTCTCAATTAAATTGTCGTTCCATTTGAAGAT
TCGCCTGTGATGTCATTCCAATATTTTAACAATTAGCTTAATTTTTATTATTTCGTGGTGATAAACAATCGGCCCATAAATTTCGCCATAAAATTAATTTTAACTGGGCTATTATTAAAT
GCATTGACTTGTTTATAATCTCATGTAATAATTCAATTCAATTTTGGCCCAAGTTTCTTAAACGGGCCCAAATAAGGCAGTGAACGCATAACAAGTGATGGCAACCTCAACGTGATGATT
CATTCATTAAATTTGTTTATTTTTTAATAATTTCGACAATTGACTTGGGCTCGAAATTAATTTAGAGTGATGGGTATTGTGGTCAATTAAACTTTTAATATTGAAATTTCAGATAAAATT
ATCAATTCGGCTCGGTCGGGACATAAAACGCGATTATAGTTGTTATAGATTAGTTTAATCGCTCTAGAAAAATAACTAATTATTAAGTTGTTTATTGATAATTAGGTAGGCAGTCCAGAC
TTAATTTTCTAATGCTGGACTCCCGTCTGACAGCTAATTATAGAACACTACACCTATACTTAAGGCGAAAATGCGGAATAAATATGTTAATTACTACAATATTATGTAAATATGCGTCAA
AGATTCAAAGATAGGTTTTATTCAAATTTTCAAAAATTAGTTACAAAGTAGTTCGAACGTTCTCGATTAATTACTTCTGGTCGGTGGTTAACCGAGCTGAACCATGATATTATTTCATTT
TTCTATCAAGAAAATATAACGGTGGTGACTGGAATTACATTGTCATTCATAAATTTAGCACTCGTTTCTTCGTACCTAAAGTTGGTGTTTTTGTGGTCTCTGATGATGGTCAGTAACACA
TGTGACAAAGATGTGACGTAATATGCTAATAGACTTGAATTTATGTGGGTATCCTAATTACAAAGCAAAACGGAGAGTTTCAAAGTCATAAAAGCACATATTGGAAGCTGCCTTTTCTAG
CACCTGACTTGTCTTTTTTTTTACTTGGCATATTTAGCCTTGATTAATATGTGTGCAAAATTGAATTTGATTCGATGGATCAATGAAAAAGATCAAGTAAGGTTAATGGGTGCAGGAGAC
TGCACTTTTATAATAGTTATTTATGGTGTCAAGATCTGTATATGCTATAATTTTCCGTAGCAGATAACAAGTTTAAAAATTTACTATTAATTAAATAATGCGTAAACTATTGGATAAGTT
AGAGCAACAACAAGAATAATTCAAGTGTGTGCAAAGTCCTTTAATCCCCTCAAATAAAGCAGTGCTAAAAATGTGTTTACTGCTCAAGATAAAAATATCTCGAGACTACGATCAAATAAT
CTCTGTTTAAATCATCGATCAATGGTCTCGGAACGTGTATACAAAAGTCACTTAACATTTATTTATCAAGTTATTTCATTGTTTTATAACTGGTGAGCTTTTAGCGAATTCTTTTACATT
TGGCTCAGGTGTATTAACCTTTTTGCGGAAATGTAAAACTATATGTAGCTGCTAATTAGTCAGCAAAATAATAATTCACAATAAACTTCGTGCAACCTTCGAGAAATGTGAACAATAAAA
ACTCTGGAATTGAAATACAGCGAAAGGCAACACAACATTAAAATTGATGAGGAAAACAACACAACAATAGTGACTACCATAAACATCTCCTGTTTGGTCCAGTTACCTTAAAAAATCAAC
TAATTATGAAAAACAACACTATTACAGTGAAACCTCTTAATAACGGACACCGCTGTGAAATTAATTGTTATTAGGAGGTGTCCATTAAGGGAGGTTTCACTGTAATTTATTAATAAAAAA
TAGACCAGTTTAAAAATATTTCTAATAGTTTAATATTTAGAAGTACAAAAAACAGAATAAAAAATACGCGTAAAGGAACAAGTTTTATTAAATAATCATCGATATTTTGTATTCATCTCG
CAGACGGGTCGTGATGGAAGTCAATCGTGCAAACAAGATTTATTTTCGGCTTTCTTAACAACCAATGATGATGAAAGAAAACTCGCTTTTATTGTTTGCTCAACACCGACACGTGAAGAA
GGTCTAATAAGATAAATGTTACCGGCAGAGGAAAGTTGATTTCAATATGTTCAAAGATACTGCTTGAACTCCGACTATTCCGACAAGTTGATTTGAAGACGAAAGAATAATATTTTAATA
GGAAATCAAAATAATGCTTTTTTTATTGAGAAGCTGTGGACTAATCAAGTTTTTTTAAAGCTTATTGTGTTGGGTTTATTAGATTTATTGTAATCTTTTCAAATATGATTTTGATCGAAG
TCAAACAAAGATATTCAACCAAATGAGGACAAATACTAGATTTAAAACTTGGTTAAAAAAATGTACGACTGTGGTGGATTCCAATTATTTAACGTAAACAATTCGGCAAAATAAAAAGTT
CTTATTAGACTAGTTTTTTTCTAACATCTGAATCCCATGTGTGTGATTCGTGTCAAGTGGAAGTCGCAATCAACAGCTGAATGTGACAATATCGGAAAATATCTACAATCTTTTAATGAA
GTTATAAACATACAATGCGTCACTCATTATTATTATTCCCTATCTGAGAAAACGTGCCTATATTGCTCAGTCCATGTAATTATATTCTCCATTGGAAAGCACTTGAATCGAAGCAATAAA
AGAGTCTAAATTTATTACACCATAATTTTAATCTAGTGTATTAATCTAAGAAATGTATATCTTACAGCATGGCTAGGAATAAAAACCGTAATAAATCATCAAAGCGATGAACCATCTAAC
ATCTAATTACAACTACATCGGGCAATCCTAAATCGAAGCGGAAATGATAAGCGGCCAAATCACCAAACGTCGATAACATGGGACACAATTTTATTCAAATGACTGTCTAATAAAGGTGTG
TCAATATTGTTAAGTTGATCAACTTCACCGGATGTGATTCTTATTTAAAGTACACCATGGAGAATGCATTAGTATCTGGTTTATATTTTTAGTTTACCAATAACGCTTTGAACAGGCACA
TACATCACAGCGAATCTTTACCAGGCCATAAATCTATTTCATTTAACAACTGATTGCGTTATCTTATTGTATTAATTAAAATTTTATTAATATCAATATGACATGCTTCTGTAACTGGAC
CAAGTCTTCATCGAAGAGGAACAATTTTTTCTACAACCATTTTTATCAAGAAACAAGAAATAAATACAAATAAATCTTTTTTTTTGTTGTTAATTGTCTTGTGTCGAGTGAATTCTTGTT
TATTACTTTTATAGAAAAATAAATGAGCAAATGTCAAATGTGATCTGAAATGTCAACAACTAGTAGTAGAAAAAATACAGTATGCAATAAAAATGAAAGCTATGCAGAAAGAAAGTAAAG
TTGGTCTTCAGAGCAGATATTTATAACTCAACCTAAACGATTGTGTAACTTTTCCAATTTTTTCCTTGAAATATGTAAATATACAAAGCACACGAAAATAGTAAGTTGAATCAATCACCG
CTTCAAAAATTATATTTAGAGGCAACTATCCACACTGCCTATCAACAAGGTAATGAAAGTGCTGAAACCAAACAAACAAAGCACTGCTAGTTGGTCATTTGGGCGAAAATGAAACTAGGA
AAAGATTTCCAAGTTCTAAAATTGAATTTTTCAGAGACCTGCGTTTTAACAAGATTAGAGACATCGTTCCTGGCAGTTTTAAAGGCCATAAGGCCCTTCGTTCTCTACTACTTAATAACA
ACTCGCTGAAAAGTCTGAAAAATGGGATTTTCACCGGTCTTGTGCAACTTCGACACTTGTATCTTTACAAAAATCGGATAAAGTATATCGAAGATGAAGTCTTTCACGGACTACCTAAAC
TAGAACATTT
GTAAGTACACCCTGTAGATACGACTCTCGACTTTTTTTTTTGGTTTTAGATACTTGCACAATAACGAGCTGGAAGAATTCAAAAGCGGAACTTTTTCGAACATTCCGCAG
CTGGACAGACT
GTAAACCAACACACAGTCCATGATTAAATGAACAAAATATGTTTTTTAGCTTCCTTTACAACAACCACATAAGTCATATCCCAGCAGGAGCTTTCCAGAACCTCCCAAA
ACTCACTCGTTTACGTCTGGACCAAAACGCCCTAGTCTGCGATTGTCGAATCGCCTGGTTCGCAAAAATGCTAAACGACAACACAATTCACGTCGCTGCTAATTGTCGGTACCCCCATGA
AATGTACGGGAAGCCCCTCAAAGGGATGACCACGCGCGATTTTCATTGTA
GTTAGTTGAGCGAAACAATTTAAAAAACGTAAGTAAAATTAGAACGTTTTAGAAGCGCCAGAGATCATGG
AGGGCCCACAAGACGTTGAAATCTCGTGGGGAAGCACCGCTGTTTTCACTTGCAGGGTGACAGGCGACCCCAAGCCGTCCATTTATTGGATGCGTGACGACAAAGAGATTGAGATGAATA
ACGACAAGTATGACATTATGGACAACGGCTCGTTGGTGATCAAACACACTGATGAGAGCGATAGCGGGCATTATGAGTGTATGGCTAAGAATGAGGACGGTGAGGTCAAGTCTAGACCTG
CGAGGATGATTCTGGTACGGCCAGATCAACAGTTCCGGGGGGGAAATG
GTAACAACTTTCTTGGAAATATTTTTGAGGCGTGACTGGAATTTATGGTTGTTTTTGTAGGTAGTCCGGTGT
TTCTTGTAACTCCAGTCAGTGTTACAACGAGTGAGTCAGACCCTTCGGTTAGTTTACATTGCAAGGCTTTTGGTAATCCACATCCTACCATAACATGGTCTCGGAATGGGATACAACTGA
CGACATCTCAGAGACATTTTATCGATGAAGATGGGACTTTGGTAATTCGACCAGTTAAAGCAAGTGACCATGGTACTTACCGGTGCGATGCTACCAATTCCAATGGGAGGATAAGCTCAG
AAGCGGATGTGATAGTAAATG
GTGAGAGTAGTTGATAAATTGCAGTTTATTACACAAGTAAAGAAAAGTTGTTTATTATCTGCTAGCACTTGAAATTATCTATTTTTTCGTCTAACCCGG
AGCCGCACTGGGGAACGGTTCCGGCTACAGAGGCGTTTAAAGTTTTATACTAACAAAAATCATTACTCAAAAACTAAAAGTCGTAGAGCAATGCGGTTTGTTCCATTGAATTTAGCGGCT
CATTTTTCGTATTGTACCAAATTTTCATGAGATTTAAAATTTTCAATTTTTTTGCTCAAATTTCCTGAGAGGTACCTTCAAAGAAATGAAAAAAAAAATTTTTTAACTCACTCCAGCAAA
TTTTTATGGACTTCTATAGTCTTAACAACCCACAAAAGTTGTGAAAAGTCCACAAAAAGTCCATATGTTCGATTTTTTGATGTTTGATTTTTTCAATTTTCGTCGCAGTTTTTGTCGATT
TTGGGTACCCGGAACATTTGTCGAGCAATAGCTCCGGAACTATTAGAGATAACCCTATGAAGTTTATTATCGTTGGAAAGCTCTTTGAATTATCTATTTTTTTCAAAAAAAATATTGTTC
TCCGACTAATAGTTTTCGAGCAAATTGGAGACAAATGCAAAATTTGGTAAAATTTAAAAAAATTCATAACTAAAAAACTATTGGGAATTTGGCAATTTTCTCGGTGCCAATCGATTCCCC
GGATCATTTTACATAGGTCAGGATCAAAACAGTTCCATTTTTTTGAATAGTTTAGCTGTAAATGAGAAAATTAAAAAAAATTAAAAAAAGTTAACACCCCCCCCCCTTAGAAATCGGTCA
ATTTTAAAGTGTCTCAAAATCAAATACAACCGATTCTATCTTATGGATTTTGATGTGCTCTTTCCGATGGAAAAAAGCGTTTTCTCCTAGCTCTTTTAGTTTGGCCGTAATCGGCATTTT
AAAATTGAAAAATTTTTTGCGAGATATCACCTTGAGTCCTATGCCATTTTGTAGAGTTTTTTATTCCGGTTATCCTCAATTTTTCCGTTTCTCGATATCTTTAATAGTTTCGCCGTAATT
GGCGATTGAAAATTGAAAAAAAGTGAAAATGGAAACCTTTTGTTGCGTTTTTCTCGGAAACTGTAAGACTTAGAGCAACGAACAAAAAATCATCTGATAGCGCTTAATTTTATCTATTTT
TTCGTTTAAACCCGGAGCCGCTCCGGGCAACGGTTCCGGCTACAGAGGCGATCAAAGTTTTTCACTAAAAAAATTCATAAAAAAAAAATAAAAGTCGTAGAGCATTGCGGTTTGTTCCAT
TTAATTCTACTGCTCATTTTACATATTATATGAATTTTTCACAAGGATCGAAAATTTTAAATTTTTTGCCTAAATTAAGGGTAGCCATTTGTCATAGTGAAAAATTTTATTCATTAAAAA
AATTCATAACTCAAAAACTAAAAGTCGTAGAGCAATGCGGTTTGTTTTATTGAATTCAGCGGTTCATTTTCTATATTATACCTACTTTTCACGAGATTTAAAATTTTCATTTTTTTCTCT
CAAATTTCCTGAGTACACTTACCTTCAAAGAGGTGGAAAAAAATATTTTTTTTAAACTCACTCCAGTAAATTTTTATGGACTTCTACATGTCTTACAACCCACAAAAGTTGTTAAAAGTC
CACGAAAACTCCATATATTCGATTTTTTGATGTTTGATTTTTTCAATTTTCGTCGCAAATTTTGTCGATTTTGGGTACCTGAAACATTTCTCGAGCAATATCTCCGGAACTATTAGAGAT
AACCCCATGAAGTGTATTATCGTTGGAAAGCTCTTTAAATTATCTATTTATTTCAAAAAAAATTATTGTTGTCCGACTTATAGTTTTCGAGAAAATGCAAATAAAAGCAAAAATGGGTAA
AATTTTAAAAAATTCATAACTGAAAAACTATTGGGAATTTGGCATTTTCCTCGAAGCCAATCGATTCCCTGGATCATTTTACTTAGGCTTGGACCAAAATAGTTCCACATTTTCGAATAG
TTTTGCCGTAATTGAGATAATAATAATAATAATAAAAATTTGCGAATGTTTCTTATTATATCAAACAAACATGTTGCAGTCGCCCCAGTCTTCACCGTCCACCCCCAAAACACCGAAACC
ACCCCCGGCTCCACCATCAAACTCGAATGCTTCGCTGTCGGCTCCCCCCCACCCGAAATCACCTGGTTCAAAGACGACCTGGAAGTCCGCTCCGACGGCCGCCTTTCCATCTCCCCAGAC
GGAAGCTCCCTACAAATCCACAACGCCAAAGAAACCGACTCAGGCCTCTACATATGCGAAGCCCGCAACCACCTCGGCTTCCGCGAAGTCAGCGCCAAAGTCAAAGTCACCCCACTCGCC
CGCAAACCGCCAAAATTCATATACAAACCCTACAACATCGAAGCCCTGGTCGGAAGCACCATTGAATTACCCTGTAAAGCAGACGGCGATCCCACACCCGGAATCCAATGGCAGAAAGAT
GGGGCTAGTTTGCAGCGAACTGGACGAACCAAAGTCTCACTGATTGGGAACTTGTACATCTATGGAGTTGTTCCAGACGACCAAGGACGCTATGAATGTGCTGCCATTAACGATTTTGGT
CGAAGTACGGCTTCCTGTTATGTCACAGTTAAGGAAAACCAGAACCCGACTGATTTCGGTATTGGGGACAAGTTTGTCAAAATCGCCTTTGACGAAGCTTCCCATGAAGTGGACAAGGCC
ATTAACAAGACCATTGATAATTTGTTTCACAACAAGGGACCACATTCTTCCGCCGATTTGTTCCGACTTGTTCGTTTCCCAGACGCCCCAGCGCGTGAATTAGCACGGGCTGCCGAAGTC
TACGAACGCACTTTAGTCAACATTCGTAAACACGTCGAACGTGGGATGACAATGAACGCCAGTTCCAATTTCAACTACCGGGAGATTCTCTCCCCTGATCACTTGAACCTAGTGGCGGAA
TTGTCCGGTTGTATGACCCACAGACTGGCCCGCAATTGCTCAGACATGTGTTTCCACTCAAAATACCGTACCATTGATGGTACTTGCAACAACTTGCAGCACCCCATGTGGGGGGCGTCC
CTGACCGGCTTCCGCCGAATATTAAAGCCAATCTACGAGAATGGTTTCAGTACCCCAGTTGGTTGGAACAAAGGGGTTAAATATTACGGGTTCCCCAAGCCCAGCTCCCGGTTGGTTTCA
ACCACGCTGATCGCCACCAAGCGAACGACCCCTGACGGGGAAATCACCCACATGGTCATGCAATGGGGGCAGTTCCTCGACCATGATTTAGACCATGCCATACCATCGGTAAGTTCCGAA
AGCTGGGACGGAATCGATTGTAAGAAATCGTGCGATTACGCCGCCCCTTGCTACCCCATGGACGTCCCCCCCAACGACCCCCGGGTCACCAACCGACGCTGCATCGATTTCATCCGATCT
TCGGCGATTTGTGGCTCGGGCATGACGTCCGTCTTCTTCGACAACATCCAACACCGGGAGCAAATCAACCAACTGACTTCGTACATTGACGCCTCCCAAGTGTACGGTTTTTCCGAAGAG
TTGGCCCGAGATTTGCGCGACTTGAACAGTGACGGTGGCCGGCTCCGTGAAGGCCCCATTTTCCCCAACCGCAAACCCCTGTTACCCTACGCCGGGAACCAGGGGGTTGACTGCCGCAGA
AACTTGTCCGAAAGCACGATCAATTGCTTCGTCGCTGGTGATATTCGCGCAAATGAGCAAGCTGGCCTTATCGCCATGCATACGCTATGGATGCGGGAGCACAACCGAGTGGCCCGTGAG
TTGAAACAACTCAACCCGCAGTGGAACAGTGATACGGTCTACCACGAGTCCCGCAAAATCATAGGTGCGGCCATGCAACACCTAACTTACCAGCACTGGCTCAGGTTTATAATAGGCGAG
GAAGGGATGCAACTTTTGGGCGAATATAAGGGTTACGACCCGACTGTTAACCCCAGCATTTCCAATGTTTTTGCAACGGCGGCGCTCCGGTTCGGGCACACGCTCATTAACCCGGTCCTG
CACCGCCTGGACTGGGACTTTAAACCGATCCGTGAAGGCCACTTGCCGCTCCACAAGGCATTTTTCTCCCCCTGGCGCATTGTGGACGAGGGTGGCATTGACCCCTTATTAAGGGGGCTA
TTCACGGTCCCAGCCAAGATCAAAAAACCCGACGAGAATTTAAACACCGCTCTCACGGAACAACTCTTCGAGACGGCACATGCCGTAGCTTTGGACCTTGCAGCTATGAACATCCACCGG
TCCAGAGACCACGCAATCCCCGGCTATATCGAGTTCCGCAAATTCTGCAACATGACCCAAGTTGATAGTTTCGAGGACCTGACGGGCGAAATCACAGATCGTTCCGTTTTGCGCAAGTTG
CAGGATTTGTACGGGCATCCGGGGAACATCGATGTGTGGGTCGGGGGTGTGCTGGAGGACCCGGTGAAAGGGGGCCGTGTCGGGCCGCTTTTCCGGTGTCTTTTAATCGAGCAGTTTAGG
AGGTTGAGGGACGGGGATCGGTTTTATTACGAGAACCCGTCCGTTTTTAAGCCGGAACAGTTGGTTCAAATCAAGCAGTATTCCCTGAGTCGGGTCTTGTGCGATAATGGGGATAATATC
ACCCGGGTTTCCAAAAACGCGTTTGTTTTGCCTGAGTTGCAAGGGGGGTTCAGTCAATGTGAGGAGATACCGAGGGTTGATTTGAGTGTGTGGTCGGAGTGTTGTAGCGATTGTCGGTAT
TCGGGTCAGTTGAATACTATTAGTAGGTTGAATGCCAGGAATAGGCGGCATTTGGATGAAGGGTTTGCGAATTCGACGCTGAAGGACGGGTATTTTGAGGAGAATCGAAAGTTGAAGAAG
AGGATTGTTAGGATGGAGAAGGATTTGACTAGTATGAAGGATACGATACAGGAGTTGGAGAGAGTTATTAGGAAGTTGGAGAGGGAGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGCGATTGTGTTTGATTTTTCTCACACTAGGACTCACCATCATTGACGCACAAAGACGGAATTATTCACAATTCCCTTGCCCTTCGAGATGTGTCTGCTTCAGGAGAACAGTGAGA
TGCATGCAACTGGAGCTGACCGAAGTCCCAAAAGCACCACTGCCCACAGTCATGCT
AGACCTGCGTTTTAACAAGATTAGAGACATCGTTCCTGGCAGTTTTAAAGGCCATAAGGCCCTT
CGTTCTCTACTACTTAATAACAACTCGCTGAAAAGTCTGAAAAATGGGATTTTCACCGGTCTTGTGCAACTTCGACACTTGTATCTTTACAAAAATCGGATAAAGTATATCGAAGATGAA
GTCTTTCACGGACTACCTAAACTAGAACATTT
ATACTTGCACAATAACGAGCTGGAAGAATTCAAAAGCGGAACTTTTTCGAACATTCCGCAGCTGGACAGACTCTTCCTTTACAACAAC
CACATAAGTCATATCCCAGCAGGAGCTTTCCAGAACCTCCCAAAACTCACTCGTTTACGTCTGGACCAAAACGCCCTAGTCTGCGATTGTCGAATCGCCTGGTTCGCAAAAATGCTAAAC
GACAACACAATTCACGTCGCTGCTAATTGTCGGTACCCCCATGAAATGTACGGGAAGCCCCTCAAAGGGATGACCACGCGCGATTTTCATTGTA
AAGCGCCAGAGATCATGGAGGGCCCA
CAAGACGTTGAAATCTCGTGGGGAAGCACCGCTGTTTTCACTTGCAGGGTGACAGGCGACCCCAAGCCGTCCATTTATTGGATGCGTGACGACAAAGAGATTGAGATGAATAACGACAAG
TATGACATTATGGACAACGGCTCGTTGGTGATCAAACACACTGATGAGAGCGATAGCGGGCATTATGAGTGTATGGCTAAGAATGAGGACGGTGAGGTCAAGTCTAGACCTGCGAGGATG
ATTCTGGTACGGCCAGATCAACAGTTCCGGGGGGGAAATG
GTAGTCCGGTGTTTCTTGTAACTCCAGTCAGTGTTACAACGAGTGAGTCAGACCCTTCGGTTAGTTTACATTGCAAGGCT
TTTGGTAATCCACATCCTACCATAACATGGTCTCGGAATGGGATACAACTGACGACATCTCAGAGACATTTTATCGATGAAGATGGGACTTTGGTAATTCGACCAGTTAAAGCAAGTGAC
CATGGTACTTACCGGTGCGATGCTACCAATTCCAATGGGAGGATAAGCTCAGAAGCGGATGTGATAGTAAATG
TCGCCCCAGTCTTCACCGTCCACCCCCAAAACACCGAAACCACCCCC
GGCTCCACCATCAAACTCGAATGCTTCGCTGTCGGCTCCCCCCCACCCGAAATCACCTGGTTCAAAGACGACCTGGAAGTCCGCTCCGACGGCCGCCTTTCCATCTCCCCAGACGGAAGC
TCCCTACAAATCCACAACGCCAAAGAAACCGACTCAGGCCTCTACATATGCGAAGCCCGCAACCACCTCGGCTTCCGCGAAGTCAGCGCCAAAGTCAAAGTCACCCCACTCGCCCGCAAA
CCGCCAAAATTCATATACAAACCCTACAACATCGAAGCCCTGGTCGGAAGCACCATTGAATTACCCTGTAAAGCAGACGGCGATCCCACACCCGGAATCCAATGGCAGAAAGATGGGGCT
AGTTTGCAGCGAACTGGACGAACCAAAGTCTCACTGATTGGGAACTTGTACATCTATGGAGTTGTTCCAGACGACCAAGGACGCTATGAATGTGCTGCCATTAACGATTTTGGTCGAAGT
ACGGCTTCCTGTTATGTCACAGTTAAGGAAAACCAGAACCCGACTGATTTCGGTATTGGGGACAAGTTTGTCAAAATCGCCTTTGACGAAGCTTCCCATGAAGTGGACAAGGCCATTAAC
AAGACCATTGATAATTTGTTTCACAACAAGGGACCACATTCTTCCGCCGATTTGTTCCGACTTGTTCGTTTCCCAGACGCCCCAGCGCGTGAATTAGCACGGGCTGCCGAAGTCTACGAA
CGCACTTTAGTCAACATTCGTAAACACGTCGAACGTGGGATGACAATGAACGCCAGTTCCAATTTCAACTACCGGGAGATTCTCTCCCCTGATCACTTGAACCTAGTGGCGGAATTGTCC
GGTTGTATGACCCACAGACTGGCCCGCAATTGCTCAGACATGTGTTTCCACTCAAAATACCGTACCATTGATGGTACTTGCAACAACTTGCAGCACCCCATGTGGGGGGCGTCCCTGACC
GGCTTCCGCCGAATATTAAAGCCAATCTACGAGAATGGTTTCAGTACCCCAGTTGGTTGGAACAAAGGGGTTAAATATTACGGGTTCCCCAAGCCCAGCTCCCGGTTGGTTTCAACCACG
CTGATCGCCACCAAGCGAACGACCCCTGACGGGGAAATCACCCACATGGTCATGCAATGGGGGCAGTTCCTCGACCATGATTTAGACCATGCCATACCATCGGTAAGTTCCGAAAGCTGG
GACGGAATCGATTGTAAGAAATCGTGCGATTACGCCGCCCCTTGCTACCCCATGGACGTCCCCCCCAACGACCCCCGGGTCACCAACCGACGCTGCATCGATTTCATCCGATCTTCGGCG
ATTTGTGGCTCGGGCATGACGTCCGTCTTCTTCGACAACATCCAACACCGGGAGCAAATCAACCAACTGACTTCGTACATTGACGCCTCCCAAGTGTACGGTTTTTCCGAAGAGTTGGCC
CGAGATTTGCGCGACTTGAACAGTGACGGTGGCCGGCTCCGTGAAGGCCCCATTTTCCCCAACCGCAAACCCCTGTTACCCTACGCCGGGAACCAGGGGGTTGACTGCCGCAGAAACTTG
TCCGAAAGCACGATCAATTGCTTCGTCGCTGGTGATATTCGCGCAAATGAGCAAGCTGGCCTTATCGCCATGCATACGCTATGGATGCGGGAGCACAACCGAGTGGCCCGTGAGTTGAAA
CAACTCAACCCGCAGTGGAACAGTGATACGGTCTACCACGAGTCCCGCAAAATCATAGGTGCGGCCATGCAACACCTAACTTACCAGCACTGGCTCAGGTTTATAATAGGCGAGGAAGGG
ATGCAACTTTTGGGCGAATATAAGGGTTACGACCCGACTGTTAACCCCAGCATTTCCAATGTTTTTGCAACGGCGGCGCTCCGGTTCGGGCACACGCTCATTAACCCGGTCCTGCACCGC
CTGGACTGGGACTTTAAACCGATCCGTGAAGGCCACTTGCCGCTCCACAAGGCATTTTTCTCCCCCTGGCGCATTGTGGACGAGGGTGGCATTGACCCCTTATTAAGGGGGCTATTCACG
GTCCCAGCCAAGATCAAAAAACCCGACGAGAATTTAAACACCGCTCTCACGGAACAACTCTTCGAGACGGCACATGCCGTAGCTTTGGACCTTGCAGCTATGAACATCCACCGGTCCAGA
GACCACGCAATCCCCGGCTATATCGAGTTCCGCAAATTCTGCAACATGACCCAAGTTGATAGTTTCGAGGACCTGACGGGCGAAATCACAGATCGTTCCGTTTTGCGCAAGTTGCAGGAT
TTGTACGGGCATCCGGGGAACATCGATGTGTGGGTCGGGGGTGTGCTGGAGGACCCGGTGAAAGGGGGCCGTGTCGGGCCGCTTTTCCGGTGTCTTTTAATCGAGCAGTTTAGGAGGTTG
AGGGACGGGGATCGGTTTTATTACGAGAACCCGTCCGTTTTTAAGCCGGAACAGTTGGTTCAAATCAAGCAGTATTCCCTGAGTCGGGTCTTGTGCGATAATGGGGATAATATCACCCGG
GTTTCCAAAAACGCGTTTGTTTTGCCTGAGTTGCAAGGGGGGTTCAGTCAATGTGAGGAGATACCGAGGGTTGATTTGAGTGTGTGGTCGGAGTGTTGTAGCGATTGTCGGTATTCGGGT
CAGTTGAATACTATTAGTAGGTTGAATGCCAGGAATAGGCGGCATTTGGATGAAGGGTTTGCGAATTCGACGCTGAAGGACGGGTATTTTGAGGAGAATCGAAAGTTGAAGAAGAGGATT
GTTAGGATGGAGAAGGATTTGACTAGTATGAAGGATACGATACAGGAGTTGGAGAGAGTTATTAGGAAGTTGGAGAGGGAGAATTAA

Retrieve as FASTA