Entry information : MtRboh04 (Medtr3g098380.1[4.0] / Medtr3g151540.1[3.0])
Entry ID 4161
Creation 2006-12-13 (Christophe Dunand)
Last sequence changes 2006-12-13 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtRboh04 (Medtr3g098380.1[4.0] / Medtr3g151540.1[3.0])
Name (synonym) MtRboh04 (Medtr3g098380.1[4.0] / Medtr3g151540.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Seedling roots
Inducers Nodulation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh04
start..stop
S start..stop
GmRboh07 1514 0 1..923 1..941
GmRboh03 1483 0 73..923 1..859
MtRboh01 1378 0 12..923 9..898
CsiRboh01 1361 0 1..923 4..922
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44912585..44913176 592 N° 2 44913265..44913427 163 N° 3 44913514..44913562 49 N° 4 44913688..44913801 114
N° 5 44914278..44914700 423 N° 6 44915200..44915583 384 N° 7 44915667..44915762 96 N° 8 44916030..44916145 116
N° 9 44916256..44916358 103 N° 10 44916540..44916613 74 N° 11 44917586..44918133 548 N° 12 44918424..44918533 110
join(44912585..44913176,44913265..44913427,44913514..44913562,44913688..44913801 ,44914278..44914700,44915200..44915583,44915667..44915762,44916030..44916145,449 16256..44916358,44916540..44916613,44917586..44918133,44918424..44918533)


exon

Literature and cross-references MtRboh04 (Medtr3g098380.1[4.0] / Medtr3g151540.1[3.0])
Literature REFERENCE 1 VandenBosch,K., Endre,G., Hur,J., Beremand,P., Town,C.D., Bowman ,C.L., Craven,M.B., Cho,J. and Fraser,C.M. ESTs from roots of Medicago truncatula 72 h after Rhizobium inoculation, 2001.
REFERENCE 2 Prasad Lohar D, Haridas S, Gantt JS and VandenBosch KA. A transient decrease in reactive oxygen species in roots leads to root hair deformation in the legume�rhizobia symbiosis. New Phytologist
(2007) 173: 39�49.
DNA ref. GenBank:   CT010504.7 (96991..102936) Phytozome 11:   chr3 (44912585..44918533)
EST ref. GenBank:   BG644996 [5' end]
Cluster/Prediction ref. Phytozome Gene 11:   31059281
Omic ref. Gene atlas:   Mtr.2439.1.S1_at   Mtr.45354.1.S1_at Legoo:   Mtr.45354.1.S1_at
Protein sequence: MtRboh04 (Medtr3g098380.1[4.0] / Medtr3g151540.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   923
PWM (Da):   %s   104716.45 Transmb domain:   %s   o361-380i443-465o503-525i538-560o575-592i728-745o
PI (pH):   %s   9.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTDEVEGEIHNHRDSDTELIALHNGSFSGPLNKRVGRRSAKLNVSNSTSAIDLNHQEQDEEKAEQDYVEVTMDIQGDSVALHSVKTVPGNNGEDEKLVLLGKGMEKKRSFGASFVRTASIRMKHVSQELKKLTSFSKQVGPQKVYDRTKSAASHALRGLKFINNKTDVGWFEVEKQFDILSTHDAFLHRSLFAKCIGMNKESEAFAGELFDAMSRRRNIHGDSINKPQLKDFWDQISDNSFDSRLRTFFDMVDKDADGRITEDEIKIICLSATTNKLSNIQKQAEEYAALIMEELDPDDTGFIMVNDLEILLLHGPTHSTRGDSKYLSQMLSIKLKGTYEYNPVRKRYRDAIYFLQDNWQRTWILVLWIGVMCGLFAYKFMQYRRKDAYEVMGHCVCMAKGAAETLKLNMAIILLPVCRNTITWLRNKTKLGIAVPFDDNLNFHKVIAVAVATGVGIHAIYHLTCDFPRLLHANSEKYKLMEPFFGKQPTSYWHFVKSWEGVTGIVMVVLMTIAFTLASPWFRKGRVKLPKPLNSLTGFNAFWYSHHLFVFVYALLVVHGIKLYLTREWHKKTTWMYLVIPIIIYALERLTRALRSSIKPVRILKVAVYPGNVLALHMSKPQGFRYKSGQYMFVNCAAVSPFEWHPFSITSSPGDDYLSVHIRTLGDWTRSLRVKFSSCLPPTHGKSGLLRAECMQGDSSPSTLPKVLIDGPYGAPAQDYKQYDVVLLVGLGIGATPMISILKDIVNNFKAMEEDEGTTIEEGTSSKSPRPSQHKRTGLNSFKTKRAYFYWVTREQGSFDWFKGVMNEVAEDDHRGVIELHNYCTSVYEEGDARSALIAMLQSLNHAKNGVDIVSGTRVKSHFAKPNWRSVYKRIALNHPQTRGVFYCGPPALTKELRQLGSDFSHNTTTKYDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 11 introns) and 5 ESTs. Cultivar="A17", "R108".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACTGACGAAGTTGAAGGAGAAATCCACAATCATCGTGACTCTGATACAGAACTCATTGCTCTTCACAATGGTTCCTTCAGTGGACCTTTGAACAAAAGGGTAGGAAGAAGAAGT
GCAAAGTTAAACGTTTCAAATTCAACTTCTGCCATAGATCTTAACCATCAAGAACAAGATGAAGAAAAAGCAGAGCAAGATTACGTTGAAGTTACTATGGATATTCAAGGTGACTCTGTT
GCTTTACACAGTGTTAAAACTGTTCCTGGAAACAATGGTGAAGATGAGAAACTTGTTTTGCTTGGTAAAGGAATGGAGAAGAAAAGATCTTTTGGTGCTTCTTTTGTTAGAACTGCTTCG
ATTCGTATGAAACATGTTTCTCAGGAGTTGAAGAAATTAACTTCTTTTTCGAAACAAGTTGGACCTCAGAAAGTTTATGATAGGACTAAGTCTGCAGCTTCTCATGCTCTTAGAGGACTC
AAGTTTATCAATAATAAGACTGATGTTGGATGGTTTGAGGTTGAAAAGCAGTTTGATATTCTTTCAACTCATGATGCTTTTCTTCATCGCTCTCTCTTTGCCAAATGCATAG
GTCAGTAT
CGTGTGTTCGGTGTTTGTGTGTCTGTGTTGTTTTCGATGTGTTTATTGAATTACCCTTGTTTTTTGGATTTTTTATGTAGGGATGAACAAGGAGTCTGAGGCATTTGCAGGTGAGCTATT
TGATGCTATGTCTAGGAGGAGGAATATTCATGGAGATTCAATTAATAAGCCACAATTGAAGGATTTCTGGGACCAGATATCTGACAATAGTTTTGATTCTAGGCTCAGAACATTCTTTGA
CAT
GTAAGTTTTTGCCTTTTCTTTCTTATGAATATTTAAACAAAAAAGGTTATGCATTAAATGCTCAAGTGTACTAACTTGGAATGTAGGGTTGATAAAGATGCGGATGGCAGAATCACC
GAGGATGAAATTAAAGAG
GTATGGAATCATAAATTTTACTTTTTAGTTTCATCAATTGATAAAACTAATTTTTTCCAGTATGTAATTTTGTCACCAACAAAATTGGATTATTCTCGATGT
TTAATTATGTTTTCACTTTTCAGATTATTTGCCTTAGTGCCACTACAAACAAACTCTCAAACATACAGAAGCAGGCAGAGGAATATGCTGCTTTGATCATGGAAGAACTAGACCCTGATG
ATACTGGATTTATCATG
GTAATTATTACTTATAAGATCATCTTATACACTACTGACTTGATCTTCGTATTCATATTTTTCACTTGGTTGCTAGTGGTACTTAAGCTGTTATTTGGTCGCT
CTGTGCAGATTTTCGAAAGGATCTTGGCATGTATTATTTATTATTCCTTATATAAAGCTTTATTTCCTTCAATTAGAGCATCTTTAAATGACATGTAAAAATGTTTTGTCTCACATTATA
ATTTTATTCCTCATTTCTCTATTGATTCAACCTCAATATTTGTAGTGAACTCTTGATGATCTCAAACATTAAAGTTCTGTTGCTAATATATTGTTGACTGTCTACTGCTCTCATTTTTTA
ATAAATTTAATTGTTTTTCATTTACCTAATCTCTGTATCAATTGTTTATCCCTAGTCTCTATCTCATACTGATGTTGCTTCTCATTTTAGCCGTAATTTTTTGGCCATTTGGTGGTTATT
GTTTTGAATGCAGGTAAATGACCTAGAGATACTCTTGTTGCATGGACCAACTCATTCTACACGAGGAGATAGTAAGTACCTGAGCCAAATGCTAAGCATAAAGCTTAAGGGTACATATGA
ATACAATCCTGTTCGGAAGAGGTATAGAGATGCCATTTACTTTCTGCAGGACAATTGGCAAAGAACTTGGATATTGGTACTATGGATTGGTGTTATGTGTGGTCTATTTGCCTACAAATT
CATGCAGTACAGAAGAAAAGATGCTTATGAAGTAATGGGTCATTGTGTGTGCATGGCTAAAGGTGCAGCTGAGACACTCAAATTGAACATGGCTATTATCTTGTTACCTGTTTGTCGAAA
CACCATCACATGGCTTAGGAACAAGACCAAACTAGGCATTGCTGTTCCTTTTGATGATAACCTCAACTTCCACAAG
GTAAGTTTTACAGACCGTTCTTCATTTGTGAGCGACAAGATTAG
AAAACTAATCTAAAAAAAAATTATAGTGGCAACTGGTGCATGGTTATCACTATCTTACGATACATGCGAGCCAAATCTCGATTCGATACTAAATTGAACCTAATCGATACGAATCTTAGT
ACGTATCTATTTGGACATGAATCTCATATTGCATCCCAATTCTTTCTAATGAATTACTACCTAAACTTAGTGCAGCCAACCACTTTTTCTGTCAGTTTTTAATAAGCAAACACTTTTCTT
TTCTCATTTGATATATAACCTGAATCTTGAATTATTTTGAGGTATATGATATATCTGCTTACAATTTTGTTATTTCACTTATTTTTTTACTTAAAAATGGTGTATTTTTATCGGCAATGT
ATCTTAGGATTCAATTCTTGATTTGGAAAAATATCTCCTGACTCAAGATTTGAATCCCGATTTGATATCCATGAAATGATGAGTGTCTGTTGCAGGTGATTGCTGTGGCAGTAGCAACTG
GAGTTGGTATACATGCTATTTATCATCTTACTTGCGACTTTCCTCGCCTTCTTCATGCAAATAGTGAAAAGTACAAGCTCATGGAACCATTTTTTGGAAAGCAACCAACAAGTTATTGGC
ATTTTGTGAAATCATGGGAAGGAGTAACGGGGATTGTAATGGTTGTTTTAATGACAATAGCCTTCACACTGGCTAGTCCTTGGTTCAGGAAAGGAAGGGTTAAGCTACCTAAACCCCTCA
ATAGTCTAACTGGTTTCAATGCCTTTTGGTACTCTCATCATCTCTTTGTATTTGTCTATGCCCTTTTGGTTGTGCATGGAATCAAACTTTACTTGACTCGGGAATGGCACAAAAAAACG
G
TTAGCACCTTCCTTGAATTATCCTTTTTATCCAGTTTCTCAGCTAATTCTTGTATATTCTAAGGATTGTATGTGTTTTGTAGACTTGGATGTATTTGGTTATTCCCATCATCATTTATGC
ATTGGAACGACTGACTAGAGCACTCAGATCAAGCATCAAGCCTGTAAGAATATTAAAG
GTGAGTGTTGAATATTGAATCAGTGTCACTACTTGAAGAAACATATGAAGGTTTTAAAATTT
TGTTCTCCAAATTCATTCATAGATATAAATTTCAGCATATTATTCACATATGCTTTCAATTGACAGATCAAGGATTGTTTATCTGGAACTTTGAAAAGATTGTTGTTCCATTAACTAATA
TTTTTTGGCTAATATTCAAAAAATAGAGATACATTAGAAAAAATAATATGCATGTCTGACCAAATTTTGTGTGTCCTATTTGAAGGTGGCTGTTTATCCTGGAAATGTGTTGGCTCTTCA
TATGTCAAAGCCTCAGGGGTTTAGATACAAGAGTGGACAATACATGTTTGTAAATTGTGCTGCTGTCTCTCCATTTGAATG
GTACTACGAATTTGAAGAAACATAATTAGTAGTCTTTGC
ATGCTATATGAATTGTTGCATCTAAATATACCTTCTTAAAATGTTAAACGTTGTTATATATGGTTTCACAGGCATCCGTTTTCCATAACCTCTTCCCCAGGAGATGACTACCTTAGTGTT
CACATCAGAACATTAGGTGACTGGACCAGAAGTCTCAGAGTCAAATTCTCAGAG
GTGTGAATTCAGGTTAACTTTTGTTGGGTAATAATGCTATTATAACTTAATTATTTTGACAACTTA
CATAGCAAAACTCACTGATTACTACATTTATCTCTATTTGGATGCATTCCAATTTTCTTAGCAATTTGTGGTTTCTCTTTTGACTATATTGCTTTGGTTTGGTTCTATATTTCAGAGTTG
CCTTCCACCGACCCATGGGAAGAGTGGACTTCTAAGAGCTGAATGCATGCAAGGGGATAGCAGCCCAAG
GTAACACACATACTATCTTTACTCCTAAATATAAGCTTTTAAAAAAAATAT
GTTTGAGTTGAGAAGGTAAAATCCATTGTGCTGATAAATATCAACAAAAAACTAATTGTCAATTGGTAGTAGCCGACATTTGCATGTAAATGGATGAGTTGTGTTGGTTGATAATGCATT
TCATATAATTTACATAATTTAGGGTGGTTCTATTTTAACTAAAATACTTTTAAATATTTGTTATTTTCTCACAAAATTTGACTAGAAAGTTACTAGAACATTTTTTAAGGTTTTTAAACA
AATTATTTAATCATTATGAAACTCTTTTTAAATCCAAAAACTTAATTATTTCAATTGGATTTGGATTTGGTTATACAGTGTGTATAATTAGTATTTACTTTACATAGATGTACTCTTTTT
TTAAGAAATGATTACCAAAATAGATGATTGATAATAAATTAAAATCAGATAATTATGCATTCATTAAATTAAGTTGTTATGTTGCTTGTTAAATATTAATATGCCGTTCCTCTTAGACTT
TGAAATTTATTCACAAAAAAACATAGACTATTTGTCTTATGTAGCTTGGGTGTGAATAAATGATAGTCTGCCGACCGATATAACCAATGCATGCAGCAATAGCACCGTGTCCAATTTGCT
TACGATTTTATTATCCTTGTGGCCAAATGGAATTGGCTGTTGATTTGAAGTTTACACTACGATGATTATTATTGTCAAAATAAATAGACTAGGTGAAAATGGACACTTGTGTTGAAAATT
CTTGTTCTCAGCTAAAGTAGGTAATCAACCCAGCCCAACATTTTAATTAGTGTTAGAAAATGTTAAATAAATATATAAAATATAAGGCTAAAGCAAGTGAATTTTTATGACATTTAGTGA
CAAACTAATGATGCATAATCATTTATAATATATGGTTTATTGCTTAGTGACCAGTAAATAATGCATTATTGTACTATGCAGTACTCTCCCTAAAGTTTTGATCGATGGTCCTTATGGAGC
GCCTGCACAAGACTACAAGCAATATGATGTAGTTTTACTTGTAGGCCTAGGAATTGGGGCTACCCCAATGATAAGTATACTAAAGGACATTGTGAATAATTTCAAGGCTATGGAAGAAGA
TGAAGGGACCACTATAGAGGAGGGAACAAGTAGTAAATCACCGAGACCATCACAACACAAGAGAACCGGTTTGAATAGCTTTAAAACTAAGAGGGCTTATTTTTACTGGGTTACTAGAGA
ACAGGGTTCATTTGATTGGTTTAAAGGAGTAATGAATGAGGTGGCTGAAGATGATCATAGGGGAGTAATTGAGCTACACAATTATTGTACTAGTGTTTATGAAGAGGGTGATGCTCGCTC
TGCTCTTATTGCTATGCTCCAATCACTTAATCATGCTAAAAATGGTGTGGATATCGTCTCTGGAACACGCGTCAAGTCTCACTTTGCTAAACCTAATTGGCGTAGTGTCTACAAGCGCAT
TGCACTTAATCATCCACAAACACGCGTTG
GTGAGTTCTCATTCTTCAACTAACATTAAGAGTATCATCTATACGCTACCGCAGAGAAATTATCATGTGTGCGTGCGTGAGATAACTAAAG
ATACTATAAAGAAATTCCAACAATGAATAATTTTTTTACCAAAACAATGAATACTTCTTAAAATTGCTTAGAGGAGACATATGATTATCCTTTTAAAAGTTGAATGCTTATCAATTTCAA
TACTGGCATGGAGAAAGAAATAATTGGTGTGGTTAATTTAATGCTAGCATCACTGAGGAGTGTGATTTATGTAATGCAGGGGTGTTTTACTGTGGGCCACCTGCACTTACTAAAGAGCTT
CGTCAATTAGGTTCGGACTTTTCTCACAACACAACCACCAAATATGATTTCCACAAGGAGAATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACTGACGAAGTTGAAGGAGAAATCCACAATCATCGTGACTCTGATACAGAACTCATTGCTCTTCACAATGGTTCCTTCAGTGGACCTTTGAACAAAAGGGTAGGAAGAAGAAGT
GCAAAGTTAAACGTTTCAAATTCAACTTCTGCCATAGATCTTAACCATCAAGAACAAGATGAAGAAAAAGCAGAGCAAGATTACGTTGAAGTTACTATGGATATTCAAGGTGACTCTGTT
GCTTTACACAGTGTTAAAACTGTTCCTGGAAACAATGGTGAAGATGAGAAACTTGTTTTGCTTGGTAAAGGAATGGAGAAGAAAAGATCTTTTGGTGCTTCTTTTGTTAGAACTGCTTCG
ATTCGTATGAAACATGTTTCTCAGGAGTTGAAGAAATTAACTTCTTTTTCGAAACAAGTTGGACCTCAGAAAGTTTATGATAGGACTAAGTCTGCAGCTTCTCATGCTCTTAGAGGACTC
AAGTTTATCAATAATAAGACTGATGTTGGATGGTTTGAGGTTGAAAAGCAGTTTGATATTCTTTCAACTCATGATGCTTTTCTTCATCGCTCTCTCTTTGCCAAATGCATAG
GGATGAAC
AAGGAGTCTGAGGCATTTGCAGGTGAGCTATTTGATGCTATGTCTAGGAGGAGGAATATTCATGGAGATTCAATTAATAAGCCACAATTGAAGGATTTCTGGGACCAGATATCTGACAAT
AGTTTTGATTCTAGGCTCAGAACATTCTTTGACAT
GGTTGATAAAGATGCGGATGGCAGAATCACCGAGGATGAAATTAAAGAGATTATTTGCCTTAGTGCCACTACAAACAAACTCTCA
AACATACAGAAGCAGGCAGAGGAATATGCTGCTTTGATCATGGAAGAACTAGACCCTGATGATACTGGATTTATCATG
GTAAATGACCTAGAGATACTCTTGTTGCATGGACCAACTCAT
TCTACACGAGGAGATAGTAAGTACCTGAGCCAAATGCTAAGCATAAAGCTTAAGGGTACATATGAATACAATCCTGTTCGGAAGAGGTATAGAGATGCCATTTACTTTCTGCAGGACAAT
TGGCAAAGAACTTGGATATTGGTACTATGGATTGGTGTTATGTGTGGTCTATTTGCCTACAAATTCATGCAGTACAGAAGAAAAGATGCTTATGAAGTAATGGGTCATTGTGTGTGCATG
GCTAAAGGTGCAGCTGAGACACTCAAATTGAACATGGCTATTATCTTGTTACCTGTTTGTCGAAACACCATCACATGGCTTAGGAACAAGACCAAACTAGGCATTGCTGTTCCTTTTGAT
GATAACCTCAACTTCCACAAG
GTGATTGCTGTGGCAGTAGCAACTGGAGTTGGTATACATGCTATTTATCATCTTACTTGCGACTTTCCTCGCCTTCTTCATGCAAATAGTGAAAAGTAC
AAGCTCATGGAACCATTTTTTGGAAAGCAACCAACAAGTTATTGGCATTTTGTGAAATCATGGGAAGGAGTAACGGGGATTGTAATGGTTGTTTTAATGACAATAGCCTTCACACTGGCT
AGTCCTTGGTTCAGGAAAGGAAGGGTTAAGCTACCTAAACCCCTCAATAGTCTAACTGGTTTCAATGCCTTTTGGTACTCTCATCATCTCTTTGTATTTGTCTATGCCCTTTTGGTTGTG
CATGGAATCAAACTTTACTTGACTCGGGAATGGCACAAAAAAACG
ACTTGGATGTATTTGGTTATTCCCATCATCATTTATGCATTGGAACGACTGACTAGAGCACTCAGATCAAGCATC
AAGCCTGTAAGAATATTAAAG
GTGGCTGTTTATCCTGGAAATGTGTTGGCTCTTCATATGTCAAAGCCTCAGGGGTTTAGATACAAGAGTGGACAATACATGTTTGTAAATTGTGCTGCT
GTCTCTCCATTTGAATG
GCATCCGTTTTCCATAACCTCTTCCCCAGGAGATGACTACCTTAGTGTTCACATCAGAACATTAGGTGACTGGACCAGAAGTCTCAGAGTCAAATTCTCAGAG
AGTTGCCTTCCACCGACCCATGGGAAGAGTGGACTTCTAAGAGCTGAATGCATGCAAGGGGATAGCAGCCCAAGTACTCTCCCTAAAGTTTTGATCGATGGTCCTTATGGAGCGCCTGCA
CAAGACTACAAGCAATATGATGTAGTTTTACTTGTAGGCCTAGGAATTGGGGCTACCCCAATGATAAGTATACTAAAGGACATTGTGAATAATTTCAAGGCTATGGAAGAAGATGAAGGG
ACCACTATAGAGGAGGGAACAAGTAGTAAATCACCGAGACCATCACAACACAAGAGAACCGGTTTGAATAGCTTTAAAACTAAGAGGGCTTATTTTTACTGGGTTACTAGAGAACAGGGT
TCATTTGATTGGTTTAAAGGAGTAATGAATGAGGTGGCTGAAGATGATCATAGGGGAGTAATTGAGCTACACAATTATTGTACTAGTGTTTATGAAGAGGGTGATGCTCGCTCTGCTCTT
ATTGCTATGCTCCAATCACTTAATCATGCTAAAAATGGTGTGGATATCGTCTCTGGAACACGCGTCAAGTCTCACTTTGCTAAACCTAATTGGCGTAGTGTCTACAAGCGCATTGCACTT
AATCATCCACAAACACGCGTTG
GGGTGTTTTACTGTGGGCCACCTGCACTTACTAAAGAGCTTCGTCAATTAGGTTCGGACTTTTCTCACAACACAACCACCAAATATGATTTCCACAAG
GAGAATTTCTAG

Retrieve as FASTA