Entry information : MtRboh05 (Medtr8g099030.1[4.0] / Medtr1g143300.1[3.0])
Entry ID 4162
Creation 2008-12-31 (Christophe Dunand)
Last sequence changes 2014-07-31 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtRboh05 (Medtr8g099030.1[4.0] / Medtr1g143300.1[3.0])
Name (synonym) MtRboh05 (Medtr8g099030.1[4.0] / Medtr1g143300.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh05
start..stop
S start..stop
GmRboh12 1736 0 1..944 1..941
GmRboh06 1726 0 1..944 1..941
GmRboh01 1634 0 1..944 1..927
CsRboh01 1628 0 1..944 1..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41550432..41551077 646 N° 2 41551277..41551436 160 N° 3 41551702..41551750 49 N° 4 41552435..41552548 114
N° 5 41555564..41555986 423 N° 6 41556666..41557052 387 N° 7 41557153..41557248 96 N° 8 41557506..41557621 116
N° 9 41558013..41558180 168 N° 10 41558285..41558444 160 N° 11 41558596..41558793 198 N° 12 41558936..41559064 129
N° 13 41559185..41559263 79 N° 14 41559367..41559476 110  
join(41550432..41551077,41551277..41551436,41551702..41551750,41552435..41552548 ,41555564..41555986,41556666..41557052,41557153..41557248,41557506..41557621,415 58013..41558180,41558285..41558444,41558596..41558793,41558936..41559064,4155918 5..41559263,41559367..41559476)


exon

Literature and cross-references MtRboh05 (Medtr8g099030.1[4.0] / Medtr1g143300.1[3.0])
Literature VandenBosch,K., Endre,G., Silverstein,K, Town,C.D., Van Aken,S., Utterback,T., Cheung,F. and Fraser,C.M. The Medicago truncatula 6K unigene set: cDNA clones selected and re-arrayed from various libraries
DNA ref. GenBank:   CR479630 Phytozome 11:   chr8 (41550432..41559476)
EST ref. GenBank:   CA921657   BG645205.1 [5' end]   DY632917.1 [3' end]
Cluster/Prediction ref. Phytozome Gene 11:   31075112
Omic ref. Gene atlas:   Mtr.30751.1.S1_at
Protein sequence: MtRboh05 (Medtr8g099030.1[4.0] / Medtr1g143300.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   944
PWM (Da):   %s   107218.41 Transmb domain:   %s   o382-401i515-537o564-586i742-759o
PI (pH):   %s   9.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNDIPKHERRWASDSVPGKATVSAGTSPGTESSYTGDEFVEVTLDLRDDDTIVLRSVEPAVINIDDSSVAGSGYDTPVSVPRSPSMRRSSSRGFRHFSQELKAEAVAKAKQFSQELRRFSWSHGHASRTLSSSSARAGTSTTAGGGFETALAARALRKQRAQLDRTRTGAHKALRSLKFISSKSNGVDAWNEVQKNFDKLAKDGFLHRVDFGQCIGMKDSKEFALELFDALGRKRRLKVEKINREELFEFWSQITDQSFDSRLQIFFDMVDKNEDGRITEEEVKIIMLSASANKLSRLQEQAEEYAALIMEELDPERLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRKKSPIRRMSRRFIYYLQENWKRLWILTLWVCIMIGLFTWKFIQYTRKDAFHIMGYCLPTAKGGAETLKFNMALILLPVCRNTITWLRSTKLSYVIPFDDNINFHKTIAGAIVIGVILHAGDHLACDFPRLVSSSEADYQKYLKGVFGHNRPSYGDIVKGVEGVTGILMVVLMAISFTLATKWFRRNLIKLPEPFSRLTGFNAFWYSHHLFVIVYVLLIIHGVKLYLVHKWYYQTTWMYLTVPLLLYASERTLRLFRSGLYTVRLIKVAIYPGNVLTLQMSKPPQFRYKSGQYMFVQCAAVSPFEWHPFSITSAPGDDYLSVHIRQLGDWTQELKRVFSEVCEPPVSGRSGLLRADETTKKSLPKLKIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEELDSVSDTSRGSDLSVGSTDSPSLNKTTPKRKKTLKTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVFSKMCSKHYSGRIGVFYCGAPVLAKELNKLCFEFNEKGPTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 13 introns) and 3 ESTs (BG645212, BG645205, CA921657, DY632917). Cultivar="A17".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGATATACCGAAGCACGAACGCCGATGGGCGTCAGACAGTGTTCCCGGAAAAGCAACTGTCAGCGCCGGTACTTCGCCGGGAACGGAGTCAAGCTACACCGGTGATGAATTTGTG
GAGGTTACGCTTGATCTTCGAGACGATGATACAATCGTTCTTCGTAGTGTTGAGCCAGCTGTTATTAATATCGACGATTCCTCCGTCGCCGGAAGCGGTTACGATACTCCGGTGTCTGTT
CCACGGTCACCGTCGATGCGGAGAAGCTCCTCGAGAGGATTCCGGCATTTCTCACAGGAGCTGAAAGCAGAGGCGGTTGCTAAGGCAAAGCAATTCTCGCAGGAGCTACGGCGATTCTCG
TGGAGTCACGGTCATGCTTCGCGAACTCTTTCATCTTCATCCGCTCGAGCCGGAACTAGTACCACCGCCGGCGGTGGTTTTGAAACGGCGTTGGCGGCAAGAGCTCTGAGGAAGCAACGC
GCTCAGCTTGATCGGACTCGAACCGGTGCTCATAAAGCACTGCGTAGTTTGAAATTCATCAGCAGTAAATCCAACGGTGTTGATGCGTGGAACGAAGTGCAGAAGAATTTTGATAAGCTT
GCGAAAGACGGTTTTCTTCATCGCGTTGATTTCGGTCAATGCATAG
GTCAATTTCTTTCTTCAAATCTCAATTTATCATAATCTTGCAATGTTTGTTCAATGCATCTTATTCTTATTTTT
TATTTTTGAGTTTCTTTAAATGCATTTTAGTTTGGTGAATTTATGGCCTAAATATTGTTTAGATCTTGAAATTAATGTTTCGTTTTGACTTGAAAGAGTCTTAATAGTAATTTAATTATC
TGAAGGTATGAAAGATTCGAAGGAATTTGCACTGGAACTCTTTGATGCTCTTGGACGAAAACGAAGGTTGAAGGTTGAAAAGATAAACAGGGAAGAACTTTTCGAATTTTGGTCGCAAAT
TACTGATCAAAGTTTCGATTCCAGGCTCCAGATCTTCTTTGACAT
GTAATCTTTCAAAGATTATTGTTTAATTGTTTATTGTTGTAGTTATATTTAATTAGTGATTAATAATCTTCGAAG
GTTACCTTTAATTTAAAACTTGCACTGGCACTATCGAATGTCAAATTAAACACCACATTATTAAATGTCACCGTATTTTACTTTAATATTTTAATGTCACTTTGAAGCTTTCTTAGCTTG
TAATTCATTCAATTATTATTGTGATCATTAAGTGCAAATTTTAAAATAATAAATCTTCATGTCTTCACAGGGTGGACAAGAACGAAGATGGAAGAATCACCGAAGAAGAAGTAAAAGAGG
TTTTTTATTTTATCATCTAATTTTGTTCTCTCATTTTATATTCAACTATCTATTGTTTACTAGTACTATAGTATACTTATGTTTGAACATTCAACCTTGATTGTAGTAATTTAAATACTA
ATTTTTTAAAAATAGTATAAGCTTTTCTTCATATGATATGATGTACGTAAAACGTTGCATCTGTGTTTAATTAATCAAACATTAGGCTGACATGGCTGCATGGGCAAACTTAATATGATG
GTTGTTAAAAATAATTACTTCAAAATCCAGCAAGTATTAATTGAGTTCAAACTTCAAACTAGACATTAATTTTCCGTGTTCTAGAGCATAATAATAGTTGGTAGTAGTAGATATTGAAGA
GTTAGTGAACAATATATGTCTTCCTTTTTTGCGGTTTTGGTCATAGAGATTTCGCTTTCATTTCTCTGATTTTACCAAATTCATGGAATTCATAGTGAAGACGTTTTCAGAGTGGAGTTG
GTGGGGGTGTGGTGGTCATTTTACGCTAAACTAAAAGCATTTCTTTTGTCACAAGATAGACATTTTCTTTTTGACAATTAGATAGATAGACATTTTCTCGTAATATTTTCTTTTTTTTAG
GGTATGTAATATTTAGTATTTTTTTACATTAATTAAATTAAATAATTCATTATCCAATTCTTGCTGTATTTCTTGTCTTCCAGATTATCATGTTAAGTGCTTCTGCAAATAAGTTATCTA
GACTGCAGGAGCAGGCCGAAGAATATGCAGCTCTCATCATGGAAGAGTTAGACCCTGAAAGACTTGGCTACATCGAG
GTATTAGCTTAGATATATGTAGTTTTTTTTTTTTTAAATATTA
GCCTTTAAAACCAACAGGTTTGGGTTTAGTTGAATGATCTACACTCCCATAACGTAATAAACCAATATTTGAATACTAATTGGGGGAGGTAACCACATTAGTTAAAAAGTGCACGTTGAT
TATTGAACATATTAATATTACTCTATTTGTCCCATAATAACGTTCAAACTATAAAAAAATCTAAAAAAAAGATTATCAATTTTATTTTCAATGTTATTTATTTATTTTATTCCAATTGTA
TCTCTAATTTATATTATGACATTTAAGAAAAATAGTTGTACTTGTAAAAAAGAAAAAGAAAAATAGTCGTAGTAGGATATTTATAAAAAGGAAAAAGTTTGATAGTGCGACAAACTATCC
ATGAAAAACAATGAATAAATAGGTACCATTGGATATTTCATTAGATTGCAGTTTATTTTGACTTTTATGTATTTTGAAAAAATAATACCACTGCCCCATGATTCGTGTGCCAGTCGCAGT
GTTATTTCTCGCACCAAGTAGCAATGCTCTTATAAAAAAATTGTCACTTTTATACATTTATCCTTACAAGAGAGGGAAAACAAATTAGCTTTTTCAATGGTAAATTAAATAGTAACGTTT
TTATAAAGAAATCGTTACTGCATGCTAATTTTGAAAGTGTCTTATATGAAATAACTCCAAAGGCTTGATGTGGTAAAATGATAGGTCTTGAATTCGAGAGAACCCGAGTTCGAGTCCCAC
TAATGTCTTTGGAGGAACGTAAATGTAAATACCTTTGTAAGTGTTCTTTGAGCTCGAAGGTCTTCCCTGCCTTAGACTGGAGCACCATCCCCTCACCCTAAAATTTTTGTAACCAAAAAA
AATATGAAATGGGAAAAAAAATTGGAAAACTGTTTTATAAGTAAAGACACGCTGATTTTGGAAGGGTATAGGTCTAGTCCCCAAGTATTTGTCTAATCGTTTTCTTTTATTTTTAAAATT
TTATTAAATTAATGCAAATGATATTTGATACGTTTGGGGTGTCGATATAGTGAAAGTGTCAAAGTTTTGTTATGTGATCCGTTGCACTCAATTTTTTTCATAAAAATAAACATACTTTCA
CGTTATTCTCTTTCCTTCATTTTAATTTCTCCTTATTCTATATAATTTCATATACAATTTTTTTTTTTGTCTCATATATAAACTTTATGATAATGAAAATTGTTATTCTCTTTCCTTCAT
TTTAATTTCTCCTTAATCTATATATGAAACAAAAGAAAAATGTCACAGTTATTGTTGGAAGGAGGAGTAATAGTTAAGAGTATAAATAAAGTAGTAATAGGTAATTTTATTCATATTGCA
AAATAACAATTGAAATTGGACAAAAATATTTTACTTATAACTTTATAAGATTAGACATTAACTAAGATATGGGGGGTGGTGAATCAAAAAACAGTGGTGCTCATATTAATTATTTGAATA
TGACTCTTTCATAATGATGGACACTCTAGTGAATATACAGTGATAATGTCAAAAAAAGAGTAGCTAAGCTCACGAGAGTAGTTAGTTGACATTATCACTATATATAATTTCTATTAGACA
ACAAAATAAGAATAAAGAATTAAAAAAAATGTTCCACTGGTATAGTTGCTAGGTCGTCCTAATTTGGTTACGTACCTTAATTCAGTCAGTGTTGAAGTAAGACCCTTTCTTTAGTCCACA
GTTGGGCCAAATTGTGTAATTGATCAAATCTCACAACATTTCCAATGTTGTTCAACCGTGTAGAAAAAGAAGGGAAAGTTGTACCAAAAAAAAAAAAGAAAAAAAGAAGGGAAAGAAAAA
ACAGGCATATTTGATAAATTATTACAAACTAGCTAGCAGTTATAAGATAAACTAATAAATTGTTGTCCAATCAACATAGCTACATTATTTGTAACTACTCCATATACCAATAATGAAACA
AATTTAACAAATTGTTGTCTTCATCCTTTTGCTCAGTCAACAAATTTAACATAAATTCTTCTACCAATAAAGAAACAAATTTAACATAAATTCAAGGCTTAATTGCACTTTCGGACCTTT
ATCTTTTCAAAAGTTGCGGTTATGGCCCCCTAACTAATTTAAATACAAAACAACCCCCTATGTTTTGATTCTTTGGCAGTTTTGGACCCCTAGTCCATTAGTGAGGTGCCACGTGCCCCC
CTAAATAATACACGTAGCACCTCACTAATGGACCGAGGGTCCAAAACTGCCAAAGAATCAAAACATAGGGGTTGTTTTGTATTTAAATTAGTTAGGGGGCCACAACCGCAACTTTTAGAA
AGATAGGGATCCAAAAGTGCAATTAAGCCTAAATTCAATCAGCTAGCTTGTATATATGTAAACTACTCCATGTGCCTTGTATATATGATTAATACTTCTAACTATTCAGTTCGTTGAGTA
AGCAAGTAGCACTGCTGATTAATATAAGTATCGGAGTCCGACTCCTCTCAAGTGTAAAGTGAGCAAATTAATTAATAACTCGAAGTAGATATTATAGATACCTTATAACAAACCATGAGA
TTGTCAAAATAATTTTCTCATTTTACACTATAATCACAGTAGCCGATCCAAATCCTAGGAATTAATAGGGACCTCGTTTTTTATTTCACCAACATAACTGTTTTTTCTGTCTTTTTTGAC
ATCTCTGAACTTCAAAGGTTAAGATAAATGTGACAAATACAGTGGTAAAATATCTTGGTGGTACGTCCATGGTGGGGAGGGGGTTAAACTGCAAAAGAAATGATACAATATAGTATTTCA
TTAAGCTTCAATTTGTGGCCTTTTGTGTTTCTTCACCTGTTACGCTTACACAGTTACACCTTACTCAACATTTATCCAAGTTTGCTGCGTTCTGTTTCCCTTGTAATGCTAATAATGCAT
ATAGTTGACATATACCGAAATTTGTTGTACACAACTCAACCTCTAATTGTTTTGTGGAATTTTGGATGGTCATTATGTTATCGCTTGTGCAGCTATGGCAATTGGAGACACTTCTTTTAC
AAAAGGACACGTATCTCAACTACAGCCAAGCTCTAAGCTATACAAGCCAAGCTTTGAGCCAGAACTTACAGGGGCTTAGAAAGAAAAGTCCTATACGCAGGATGAGCCGCAGATTTATTT
ATTATTTGCAAGAGAATTGGAAGAGACTTTGGATTTTAACATTGTGGGTATGCATCATGATTGGGCTCTTCACGTGGAAGTTTATTCAATATACGCGAAAGGATGCTTTCCATATAATGG
GTTACTGTCTTCCCACAGCCAAAGGTGGGGCTGAGACCCTGAAGTTCAACATGGCACTTATACTCTTGCCCGTCTGCAGAAACACCATAACTTGGCTCAGGTCTACCAAGCTGTCCTATG
TTATACCTTTTGACGATAACATCAACTTCCACAAG
GTACGCATTCATACCACAAGGAAACCTGCATAATCTGGAAACTATTTTATTATGGTGTTTGACCGTCATCATATCTTGTTTATTC
TTCCACACTTGCAATTTTAGAACTAGTAATAATTAGTAAAATTGATGAATCCCCGGTGAATAAAGTGAAAATGCAAACTAAAATATAAAATATGAAGTGCGCACACAAAATAAATTTCAA
TAATGGCCTAGCAATAGAAAATTTCACCAAAAATAAAAGTCTAGCAAAAAGAAGTAATAGGTAGATTAGATATGTTTTTACATATACTACTAATGCAAATATATTTAACTATTTTCATGT
TTTTACTATAACTGTTTTAATTTTATATTACCTTATTCTTGTATAATGAACTTTAATCCTCAATTTTAAGAAATATCTCTATGAGATCCTTACTCGTTTTTTTATTTTTTATTTTATTTT
TTATTATAAGAAAGTTCTTACTAGTTTGTGAATTAAATTATCATGCGAAAAATAATCCCAGTACTCAATACAATATTCTAAATTTGACATAAAGAAGATATTTTATTTCATAAAAAACAA
GGGAAAATATTTTCTGTCAAAAAATTAAAAAGATAGCAGAAACTTCAACAGTAAGTTTATGTAAATTCTATGGTGATGTATATGATTTCAGTTTTTACTTTGAGATTCTTACAGACAATT
GCTGGGGCAATCGTGATTGGTGTTATACTTCATGCCGGGGATCACCTTGCTTGTGATTTTCCAAGACTTGTAAGTTCGTCTGAAGCTGATTATCAGAAGTATTTGAAAGGTGTATTTGGT
CATAACAGACCCAGTTATGGAGACATAGTAAAAGGGGTTGAGGGTGTCACTGGAATTCTGATGGTGGTTTTAATGGCAATATCATTTACACTTGCAACAAAATGGTTCAGGAGAAATCTC
ATTAAGCTGCCTGAACCATTTAGTAGGCTCACTGGCTTCAATGCTTTCTGGTATTCACACCATCTGTTTGTCATTGTCTATGTTCTGCTCATCATCCATGGTGTAAAACTTTACCTCGTG
CACAAATGGTACTATCAAACG
GTATATAATTTAGAGAATGGGATTTCACTTGTTTAGGATATTTATGAAATGCATTGCTTAAGGTGATTAGTTATTTGACGCCTTGAGTTTTGATTTTCA
GACATGGATGTATCTTACAGTTCCGCTTTTACTCTATGCATCCGAAAGAACACTCAGATTATTTCGCTCTGGTTTATATACAGTCCGTCTAATAAAGGTGAGCATAGGAAGTGAAACAAT
TAGTGGCAGGCTCTTCAAATTAGTTTCAACTTCATTATGTATACACATCCATTATTTGTTTTGTATACAACACAATTTGCTGTTCTGGACTAATTTATATATCTAAATTCCAGTGAGTGG
AGTTCAACACAGTAAAAATTGTATATATCATATTTTGTAAATCAAACTATCCTGTAAATGAACCAACACTAACTTCTTTCCTCTTCCTTTTATTTTTATGTGAAAAACATTTAGGTTGCT
ATTTATCCTGGAAATGTTCTCACATTGCAAATGTCCAAGCCTCCTCAATTTCGCTACAAAAGCGGACAATACATGTTTGTACAATGTGCTGCTGTCTCTCCGTTTGAGTG
GTAAGTTATA
TTTCAGTTTTTTGCGTTATTTTGCAATAACTCTGGTGATTTTTCGGTTGCATGTTACATTGTTACAGTTTAAATCAGCGTTCATATAATATTTGGGTTTTAAGTTAAGGGCTTCTTTTTA
AGGAAAAGGAGAGAAATCAATATAAATTGTGGATAGTTAACTACCATCTGCATATGTTAGTATCCATAAAACAGAGATAGCAGGTGTCCCTCATTGACATTGAACTAGAAAAGAAGGGAA
ATGTGAAGTGATATCACATTTTAATGACCAATAAAGAGTCTTGATTCTGTTTCAGAGCAAAATTTTTGGCATTGTTTCCCAATTTAACTAGCATCGTGTGTCGGTATCTAACACTAACAT
GAGGTGATATATTTATTACAGGCATCCGTTTTCTATTACCTCAGCCCCTGGGGATGACTATCTGAGTGTTCACATTCGACAACTGGGTGACTGGACTCAGGAGCTTAAAAGGGTATTTTC
TGAGGTTTGTGAGCCTCCTGTGTCCGGAAGGAGTGGGCTTCTCAGGGCTGATGAAACGACAAAGAAAAG
GTGAATGTAGCTCTCCTGTAATATATTTTTGCCTCCAAATTTTTGGTCATC
AATTATAACCTATACTGAAAATTCTGCTTACATCTTGTTAACTGTTGATAAAGTTTGCCTAAGTTAAAGATAGATGGACCTTATGGTGCCCCAGCACAAGACTACAGAAAATACGACGTT
TTGTTGTTGGTCGGTCTCGGTATAGGAGCAACTCCTTTCATCAGCATTCTGAAAGATCTTCTCAACAACATTGTCAAAATGGAGGAGCTGGCG
GTGAGTGCTACTGATAATAGAAAACGT
GTTAAAATCCATGTATAAAAAGTAATAATGATATGTTATAGTACAACTATACTGATTCTCATTTTAATTTTTGTTTGTAAATAAAGTAAATTAACCATCAGCACTACTTCTATGTTCTAT
CCAGGACTCAGTCTCTGATACAAGTAGAGGTTCAGACCTTAGCGTTGGGAGTACTGATTCACCATCTCTTAATAAAACTACTCCAAAAAGGAAGAAAACACTGAAGACTACCAATGCTTA
TTTCTACTGGGTTACAAGAGAGCAAGGCTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAGTAGCTGAGCTTGATCAAAGG
GTACATTGGTTATTGCAGAAGATTTTATTTATGTTATA
GATACTTGCTCCTAAAGAATTATAAGTATTCCTTTTCCCTTCTGCAAGATGAATAAGGATTACTTGCAATTGGCTAATATTGATCGTCAAATTATGGACTTCAGGGTGTCATTGAGATGC
ACAACTACTTAACTAGCGTATACGAGGAAGGAGATGCTAGATCCGCCCTTATCACCATGGTTCAAGCACTTAACCATGCCAAAAATGGAGTTGATATTGTTTCTGGAACCAGG
GTAAGCA
TTCTATTTTTGTTATATACGATGCATTTGAGTACCCTACCCTTGATACTCTTTTAATTTCTAAGTCCGGAGTGAGTAAATTAAAATAGCTTCTTTTGAATTTCTAATTATCAGGTACGGA
CGCATTTTGCTAGGCCTAATTGGAAGAAAGTTTTCTCAAAAATGTGTTCCAAGCACTATAGTGGACGAATAG
GTTTGTCTCCATCAAGTATATGTTGGTACTTCATACATGGTAGTATGG
TAGACTTTTTCTGTTTTTCTTGCATTGACATTATTGCTGTCTTAATTCGTATCAGGTGTATTTTATTGTGGTGCGCCGGTTTTGGCCAAAGAACTTAATAAACTATGCTTCGAGTTCAAT
GAAAAGGGTCCAACAAAATTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGATATACCGAAGCACGAACGCCGATGGGCGTCAGACAGTGTTCCCGGAAAAGCAACTGTCAGCGCCGGTACTTCGCCGGGAACGGAGTCAAGCTACACCGGTGATGAATTTGTG
GAGGTTACGCTTGATCTTCGAGACGATGATACAATCGTTCTTCGTAGTGTTGAGCCAGCTGTTATTAATATCGACGATTCCTCCGTCGCCGGAAGCGGTTACGATACTCCGGTGTCTGTT
CCACGGTCACCGTCGATGCGGAGAAGCTCCTCGAGAGGATTCCGGCATTTCTCACAGGAGCTGAAAGCAGAGGCGGTTGCTAAGGCAAAGCAATTCTCGCAGGAGCTACGGCGATTCTCG
TGGAGTCACGGTCATGCTTCGCGAACTCTTTCATCTTCATCCGCTCGAGCCGGAACTAGTACCACCGCCGGCGGTGGTTTTGAAACGGCGTTGGCGGCAAGAGCTCTGAGGAAGCAACGC
GCTCAGCTTGATCGGACTCGAACCGGTGCTCATAAAGCACTGCGTAGTTTGAAATTCATCAGCAGTAAATCCAACGGTGTTGATGCGTGGAACGAAGTGCAGAAGAATTTTGATAAGCTT
GCGAAAGACGGTTTTCTTCATCGCGTTGATTTCGGTCAATGCATAG
GTATGAAAGATTCGAAGGAATTTGCACTGGAACTCTTTGATGCTCTTGGACGAAAACGAAGGTTGAAGGTTGAA
AAGATAAACAGGGAAGAACTTTTCGAATTTTGGTCGCAAATTACTGATCAAAGTTTCGATTCCAGGCTCCAGATCTTCTTTGACAT
GGTGGACAAGAACGAAGATGGAAGAATCACCGAA
GAAGAAGTAAAAGAG
ATTATCATGTTAAGTGCTTCTGCAAATAAGTTATCTAGACTGCAGGAGCAGGCCGAAGAATATGCAGCTCTCATCATGGAAGAGTTAGACCCTGAAAGACTTGGC
TACATCGAG
CTATGGCAATTGGAGACACTTCTTTTACAAAAGGACACGTATCTCAACTACAGCCAAGCTCTAAGCTATACAAGCCAAGCTTTGAGCCAGAACTTACAGGGGCTTAGAAAG
AAAAGTCCTATACGCAGGATGAGCCGCAGATTTATTTATTATTTGCAAGAGAATTGGAAGAGACTTTGGATTTTAACATTGTGGGTATGCATCATGATTGGGCTCTTCACGTGGAAGTTT
ATTCAATATACGCGAAAGGATGCTTTCCATATAATGGGTTACTGTCTTCCCACAGCCAAAGGTGGGGCTGAGACCCTGAAGTTCAACATGGCACTTATACTCTTGCCCGTCTGCAGAAAC
ACCATAACTTGGCTCAGGTCTACCAAGCTGTCCTATGTTATACCTTTTGACGATAACATCAACTTCCACAAG
ACAATTGCTGGGGCAATCGTGATTGGTGTTATACTTCATGCCGGGGAT
CACCTTGCTTGTGATTTTCCAAGACTTGTAAGTTCGTCTGAAGCTGATTATCAGAAGTATTTGAAAGGTGTATTTGGTCATAACAGACCCAGTTATGGAGACATAGTAAAAGGGGTTGAG
GGTGTCACTGGAATTCTGATGGTGGTTTTAATGGCAATATCATTTACACTTGCAACAAAATGGTTCAGGAGAAATCTCATTAAGCTGCCTGAACCATTTAGTAGGCTCACTGGCTTCAAT
GCTTTCTGGTATTCACACCATCTGTTTGTCATTGTCTATGTTCTGCTCATCATCCATGGTGTAAAACTTTACCTCGTGCACAAATGGTACTATCAAACG
ACATGGATGTATCTTACAGTT
CCGCTTTTACTCTATGCATCCGAAAGAACACTCAGATTATTTCGCTCTGGTTTATATACAGTCCGTCTAATAAAG
GTTGCTATTTATCCTGGAAATGTTCTCACATTGCAAATGTCCAAG
CCTCCTCAATTTCGCTACAAAAGCGGACAATACATGTTTGTACAATGTGCTGCTGTCTCTCCGTTTGAGTG
GCATCCGTTTTCTATTACCTCAGCCCCTGGGGATGACTATCTGAGTGTT
CACATTCGACAACTGGGTGACTGGACTCAGGAGCTTAAAAGGGTATTTTCTGAGGTTTGTGAGCCTCCTGTGTCCGGAAGGAGTGGGCTTCTCAGGGCTGATGAAACGACAAAGAAAAG
T
TTGCCTAAGTTAAAGATAGATGGACCTTATGGTGCCCCAGCACAAGACTACAGAAAATACGACGTTTTGTTGTTGGTCGGTCTCGGTATAGGAGCAACTCCTTTCATCAGCATTCTGAAA
GATCTTCTCAACAACATTGTCAAAATGGAGGAGCTGGCG
GACTCAGTCTCTGATACAAGTAGAGGTTCAGACCTTAGCGTTGGGAGTACTGATTCACCATCTCTTAATAAAACTACTCCA
AAAAGGAAGAAAACACTGAAGACTACCAATGCTTATTTCTACTGGGTTACAAGAGAGCAAGGCTCTTTTGATTGGTTCAAAGGAGTCATGAATGAAGTAGCTGAGCTTGATCAAAGG
GGT
GTCATTGAGATGCACAACTACTTAACTAGCGTATACGAGGAAGGAGATGCTAGATCCGCCCTTATCACCATGGTTCAAGCACTTAACCATGCCAAAAATGGAGTTGATATTGTTTCTGGA
ACCAGG
GTACGGACGCATTTTGCTAGGCCTAATTGGAAGAAAGTTTTCTCAAAAATGTGTTCCAAGCACTATAGTGGACGAATAGGTGTATTTTATTGTGGTGCGCCGGTTTTGGCCAAA
GAACTTAATAAACTATGCTTCGAGTTCAATGAAAAGGGTCCAACAAAATTTGAGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA