Entry information : MtRboh03 (Medtr1g083290.1[4.0] / Medtr1g099800.1[3.0])
Entry ID 4165
Creation 2007-07-23 (Christophe Dunand)
Last sequence changes 2007-07-23 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information: MtRboh03 (Medtr1g083290.1[4.0] / Medtr1g099800.1[3.0])
Name (synonym) MtRboh03 (Medtr1g083290.1[4.0] / Medtr1g099800.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Cell culture
Roots
Inducers Elicitor treatment (glucan, oligosaccharides, yeast extract, Phytophthora crude extract)
Nodulation
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh03
start..stop
S start..stop
GmRboh02 1578 0 1..885 1..885
GmRboh15 1575 0 1..885 1..871
GmRboh10 1538 0 53..885 1..825
MtRboh02 1531 0 1..885 1..895
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37062323..37062818 496 N° 2 37064023..37064182 160 N° 3 37065834..37065882 49 N° 4 37066062..37066175 114
N° 5 37066355..37066783 429 N° 6 37066887..37067273 387 N° 7 37067383..37067478 96 N° 8 37067584..37067699 116
N° 9 37067820..37067922 103 N° 10 37068049..37068125 77 N° 11 37068281..37068801 521 N° 12 37068899..37069008 110
join(37062323..37062818,37064023..37064182,37065834..37065882,37066062..37066175 ,37066355..37066783,37066887..37067273,37067383..37067478,37067584..37067699,370 67820..37067922,37068049..37068125,37068281..37068801,37068899..37069008)


exon

Literature and cross-references MtRboh03 (Medtr1g083290.1[4.0] / Medtr1g099800.1[3.0])
Literature Watson,B.S., Shin,H.-S., Lopez-Meyer,M.,Scott,A.D., Harris,A.R., Gonzales,R.A., Bell,C.J., Flores,H.R., Inman,J.T., Weller,J.W., May,G.D. and Paiva,N.L. Expressed Sequence Tags from the Samuel Roberts Noble Foundation Medicago truncatula nodulated root library.
DNA ref. GenBank:   AC134522.9 (10121..16803)   AC136288.23 (1..6544)   AC161241.18 (26403..19721) Phytozome 11:   chr1 (37062323..37069008)
Cluster/Prediction ref. Phytozome Gene 11:   31093632 UniGene:   Mtr.15143   Mtr.17666 [3' end]
Other ref. Gene atlas:   Mtr.32104.1.S1_s_at   Mtr.39812.1.S1_s_at
Protein sequence: MtRboh03 (Medtr1g083290.1[4.0] / Medtr1g099800.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   885
PWM (Da):   %s   100739.88 Transmb domain:   %s   o333-352i473-495o515-537i698-715o
PI (pH):   %s   9.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIDQENKHESWSEPESTGSRSSGVGLSGPLASKKQRNRSKNKSASFKDDGEMVEITLNVRDDSVSVQNIRGGDTETAFLASQLEKRPSSLSAKLRQVSQELKRMTSFKAFDKVDRSKSGAARALQGLKFMTKNVGSEGWSQVEKRFDELAVEGKLPKTRFSQCIGMNESKEFAGELFDALARRRGIVAASITKEELREFWDQITDQSFDSRLQTFFGMVDKNADGRITEEEVKIIALSASANKLSKLQERAEEYAALIMEELDPNNLGYIELYNLEMLLLQAPAQSAHITTDSRVLSQMLSQKLVPTKERNPIKRAFRELAYFMEDNWKRIWIIALWLSICAALFTWKFIQYKRRAVFHVMGYCVTTAKGGAETLKFNMALILLPVCRNTITWLRSRTRLGMVVPFDDNINFHKVIAFGIAIGVGLHAISHLTCDFPRLLHATDEEYEPMKQFFGDERPNNYWWFVKGTEGWTGVVMVVLMAIAFILAQPWFRRNRLNLPKPLKKLTGFNAFWYSHHLFVIVYVLFIIHGYFLYLSKKWYKKTTWMYLAVPMILYGCERLLRAFRSGYKSVRILKVAVYPGNVLALHASKPQGFKYTSGQYIYVNCSDISPFEWHPFSITSAPGDDYISVHIRTLGDWTSQLKGIFAACQPANDDQSGLLRADMLPGKSSLPRMPRLRIDGPYGAPAQDYKNYEVLLLVGLGIGATPLISILKDVLNNIKQQEEDLEEGGEVESGVKNNKKRPFATKRAYFYWVTREQGSFEWFKGVMNEVAENDKEGVIELHNYCTSVYEEGDARSALITMLQSLHHAKNGVDVVSETRVKTHFARPNWRNVYKHVALKHPEKKGVFYCGAHGLVGELRKLSLDFSRKTGTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, 11 introns) and 6 ESTs (AW684622, AW329243, DW017704, BE240341, BE240342 and BF648094).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAATTGATCAAGAGAACAAACATGAATCATGGTCGGAGCCAGAGAGCACCGGAAGCCGAAGCTCAGGGGTGGGCCTCAGTGGGCCTTTAGCATCCAAAAAACAACGAAACCGAAGC
AAGAACAAAAGTGCAAGCTTCAAGGACGATGGTGAAATGGTGGAGATAACATTGAACGTACGTGATGACTCCGTTTCCGTTCAGAATATTCGCGGTGGAGACACTGAAACGGCGTTTCTG
GCAAGCCAGCTTGAGAAGCGTCCATCGTCGCTTTCGGCTAAACTGAGACAGGTGTCTCAGGAGCTGAAGCGCATGACGTCTTTTAAGGCGTTTGATAAGGTTGATAGGTCAAAATCTGGT
GCTGCTCGTGCTCTACAAGGTCTTAAGTTTATGACAAAAAACGTTGGAAGTGAAGGTTGGTCCCAAGTTGAGAAGCGTTTTGATGAGTTGGCTGTGGAGGGAAAATTGCCCAAGACTCGA
TTTAGCCAGTGCATAG
GTATGTCCATGTTATGGTCTATACTTCCTTTTCATCATTTACTTTTGTTTGCGTAAAAATGGAAGTTCAATCGACATAATGGTCATTCAATAAAAGACATATGT
TTGGTCTATTAGGATCACTCATTTATAATGGAAACCTCAATAAAACCTCGAACATGAAAAAGAAAAGAAAAAAAATGGGGACTAACCATAAATAACATTGCTATAATGGAATGAGTCACA
CACACAGTATATTCCGTTGTTTCTTAACAAAACTAGAGTGATGTGAAGAGGTTTTTTGAACATAGCGTAAAACTAGTTTTTCTATGACCAGCAATTAATCAATCAACGGGGTGATTGTGT
ATATGTTACTATTGTAGAGAAATTGAGACATGCATTATATGTGTAAATAATTTCAAGATAACAACTTACTTCCATCAGATAGTCTAAGATATAAATTCTATGATATGTGTAAATTGATTG
GATGCAATAAAAAAATTCAGAATTTTACGGCTATTTTAAAATCACAATTACAAAATACTAGTTAGGATCTTCTCCATTAGTTTCAAAAAATATATAAAATAATTAATGACAGTAAGACTC
ACTCAGTTGTATAATCTATTATCTATTTTTCTTTGAATTGCGTCCTCCATTTATCTTTGAGTGATGGAGAGGATTTTTTACTCACAAAATAAATTTACTAAGTAATATTATGAGTTTCGA
TCAAAGATTGTTGTAAAACTAATAATGCATCTCAATTAAAGTCTATTATGCATGCGTGTCTTGGTCTTGCTTTAATTAATTTTATCATTACTAGTATGATCTATACACTACAATAAATTC
GGGATTTACTCTTTAAAAAAACATATAAGGAATTTAGTAACATTTAAAAAGTGTTACAAAGTCAAGAAAAATGTTACTATTTAGACATGTTTCAAATAACTGTTAAATAGTAACATTTTA
TCCATGTTATCGGGTAAACGTTAGGGAAAATCATATGTGTAGTAGTGATAACTAAAAATTATTGCATAAACTAGCATAGAAACAATTTACTAGACAAAACTTCCATTTTAGGTTTCTTAA
CATGTACCCTTGACATTTCTTTAATTAAAATTATAAATTTGTTTAGTGAAAAAATGTAAATTATAATAGAATGTATTTTAAGATACTCTTGCTGAAACTAATATTATTTTTTAATTTGGG
GTGGAAATGACAATGATTAGGAATGAACGAGTCAAAGGAGTTTGCTGGTGAGTTATTTGATGCCTTAGCACGTCGTCGAGGTATAGTAGCTGCTTCCATAACAAAGGAAGAGTTGCGAGA
ATTTTGGGACCAAATTACTGATCAAAGCTTTGATTCAAGGCTTCAGACCTTTTTTGGCAT
GTAAGAAGACTTCATAATTTCATTTCCATTTTTACGAAATTTCTGTTTCAACAGGAAATT
AATTGTTGTGTCTGTCCAAGGTAACTCATTGTCCCTTAAGTGTAGCTCAATGGGTAGCTACGGGGAACATTATGTGCATGGGTTGGGTTACGAACTTCAGAATTTCCACTTCTTTGCACA
TAATGTGTGAATTTAACCATTAGATTACTTAAAAAAAAAAAAAAACTTATCAACTATGAGGATATGTACACGAGAAATGTCAATTTAAGTTGTCAGCAAGATAGAGACGGCCAAACGGAT
TTTATTGGGTTCAAAATTGAAATGTGTTCTCAGTATTTGGACTAAATTGTCCAAGTAGAGTGCTCAGTTTTCTAATCATTCTAGAAAGTTGTTATAGATTTGCGTGATCTTCACTTAAAA
TATTTCGCAATCGTTTTGAAATAGATAAACCGCACTCAGTTGCATAATTCAACCTTGTTTACTAAATTCCAAACAGTAATATTAATTGATTGATGAGCATGTTAAGTTACAACTTACAAG
GATTTTTCTATTACAGATTAAATGCACACTATTCATAAATGTAGAATGTGTATGAATAATTAATATTCGTAAAATTATTATGAGATTTATATGAATGGAAATGATATTATTATTATTATT
ATTGGGTCGTGCTAACCAGTACTCCTGTTACCGTGGTTATATGGGATCATGCTGGTGTCTTTATAGTATTAGTTAAGAATGTAAAACATAGAAATTTTTAATTGATACCAACAAAAAAAA
AAAATATTTTTAAATAGTTGAATATACAACTTTTCATCACTTTGCAACACAATATTTCTATTTCAGTGTTTTTAACAAATGCGTAACACTCTTTAGCATTTCCTTTATTAAAATTTACAT
TATTTTATTAGATGTTCAGATCATTTAGTTTGAACTATGATATTTAGACACACAAAAGCTAATACCTAATGTTACATATTGTATACAATTAACATTGAAAGTGTTGATGGTGGACCTAGA
GAGAAAGAAAGAATTATATAAAATGCAAAACCGTATAAAAATAAAGTGTGTTTTAATAATATTTTTTTAGTTCCATAGAAAATTATCTCTGTTGCTGAATATTGGATTTTGACATGTAAT
ATTGGAATATTCTTTATGGTTGGATTATTTATTCATACATACACTTCAGCGTACCCTTGAACAAAGTTTATTATATGGGCTAGTTATATGGAACACAAATAACATTGCATCATGCACATC
TTATCTTCTATTATTAGATCAATAAACCTCACTATTATGATGAGTTTTATTATTAAAAAAAAAAAAAAAAAACTGTGCATTGTGCAAAATTACCTTATTTATACACATTAGACAAAGTCT
ATTGTAGCAGTTAAAAATTAAAGCAAACAAAAACAAGAAGGGTGTCGTATATATGCATGGGATCAACTAATTGTAAATAATGGTTGGTTATGGTTAGGTTGTTGACTATAGAAAAATATA
CTAGTACTTAGAGTTAGCATGATTTGAATAAAAGAATAATTTATTTTCGTGCCTAATGTAGCAAAACTGTACTACTTTTTAACTACTTTTTTTTGTGATCTATACTTTGTAACTTGGTGA
TTCATATATTTCACTCATGCCACGATGCCAGGGTGGACAAGAATGCTGATGGACGAATTACTGAAGAAGAAGTAAAAGAGGTGAGAATTTATTATTATAATTATTCTTTTTTGTTAATTT
TATTGTTACTACTTATTACTAAGTGAGTGTCCAATTGGCCATTAGACAAAATTATTATTAAAATTTCTAATATGTTATATAGTTATTTACAAGACACATGTGGAGGTGTGAACGTTGTAG
TATGCTTCATGTATTTCAGATTATTGCTTTAAGTGCTTCGGCCAATAAGCTATCAAAGTTACAAGAACGAGCAGAGGAATATGCTGCCCTTATCATGGAGGAGCTAGACCCAAACAACCT
TGGATATATTGAG
GTTTGTAAATTCTTTAAATTAATAATTAAATTAAGTTGATCAGCTAGAAAATGGAGCTCATTAGTGAGAAATGGCCTCATCAAAATTGAGCCAGTAAATTATATTTT
AATTTGTTTTCTTAAATTAAATATACACATATATATAATTCTTCATTAAATTTTTTATCTCATTTTCTGCAGCTGTATAACTTGGAAATGCTTCTTTTGCAAGCACCAGCACAATCAGCT
CACATAACTACAGATAGTAGGGTATTGAGCCAGATGTTGAGCCAGAAGTTAGTCCCTACTAAAGAGCGCAACCCTATTAAACGGGCTTTTAGAGAACTAGCTTATTTTATGGAGGATAAT
TGGAAACGTATTTGGATCATAGCTCTATGGCTTTCAATTTGTGCAGCACTTTTCACTTGGAAGTTCATCCAGTACAAACGTCGTGCCGTTTTCCATGTCATGGGCTATTGTGTCACCACG
GCTAAGGGCGGTGCCGAGACGCTCAAGTTTAACATGGCCTTGATCTTGTTGCCTGTATGTAGAAACACCATCACTTGGCTTAGGAGTAGGACCAGGCTTGGAATGGTGGTTCCATTTGAT
GACAATATCAACTTTCACAAG
GTATATTAGATTTTGGATTAATCATATAGTATATTACTTCTATTTTTCTTTGACTCTACAAACAAAATTAGTAACTCTTTTTTTTCCTCTTGCTATTAT
TTAGGTGATAGCTTTTGGCATTGCAATTGGGGTTGGATTACATGCAATTTCACATTTAACTTGTGACTTCCCAAGATTATTACACGCCACAGATGAAGAATATGAACCCATGAAACAATT
TTTTGGAGATGAAAGACCTAATAATTATTGGTGGTTCGTTAAAGGAACCGAGGGTTGGACCGGTGTGGTCATGGTTGTGCTTATGGCTATAGCTTTCATTTTAGCACAACCTTGGTTTCG
TCGTAATAGGCTAAACCTTCCAAAACCCCTCAAGAAACTCACTGGTTTCAATGCATTTTGGTATTCACATCACCTTTTTGTCATTGTTTACGTGCTATTTATCATTCATGGATACTTCCT
TTACCTTAGCAAGAAATGGTATAAGAAAACG
GTACGTGCTCTTACTCAAACTAATGTGTTTTCCGTTCCATTTTATTTGTTTTTTCATCTTGTTGATTATTTGGTGAATTTTTTGTTACA
AAATTATGTGACATATATAGACATGGATGTATCTTGCGGTTCCAATGATACTATACGGATGCGAAAGACTACTTCGTGCATTTAGATCTGGCTACAAATCTGTGAGGATACTAAAGGTAC
ATTTTTAAGAATTTCATTTCACTCCCTTCATCTTCAATTTTGTAATTAATTTAATGGTATTGTAAATGATCTTATAATGTTATTCAATGAAAAAATTCCAGGTTGCAGTGTACCCGGGAA
ATGTACTAGCATTGCATGCATCTAAACCACAAGGGTTTAAGTACACTAGTGGACAGTATATTTATGTTAATTGTTCAGATATCTCCCCATTTGAATG
GTATGTGCCTAATTAAAGTTCCA
AATTCTTATTCTTATACTGTTGTATCTATTCATACAATTACAGTGACCAGTTGATTTTATAGAGTATTACTTGATTTTACTTGCAATTTGTCTACAGGCATCCCTTTTCTATTACATCAG
CTCCTGGAGATGACTATATAAGTGTTCACATTCGAACTTTGGGCGATTGGACGTCACAACTGAAGGGTATTTTCGCCAAG
GTAAATAAATACTCGTGCACAAGAGAAAGAGTTATGTTAT
TTTAATTTGGACTTCAAAGTTGTATATTTATTTGATATTGTTCATGATCATGGCATTAGTTACATTCATCGTCGTGATTTACGCAGGCATGTCAACCAGCAAATGATGACCAAAGTGGTC
TTCTAAGAGCTGATATGTTACCAGGCAAATCAAGCCTACCAAG
GTATAGTTAAACCTTTTTAATGATCTGACCATTATGATTGATTCAAGGTGTAAAAAATATTTACACCAACGGTGTAT
GTGAATTATTTTTCTATGAAATTGATAGGATAGCTTTCTTCTTCATCATAGTGAAACTCAATTTTAAATAAAATGTAGGATGCCAAGGCTACGAATTGATGGACCTTATGGAGCACCAGC
ACAAGACTACAAAAACTATGAAGTCCTTCTTCTAGTAGGGCTAGGAATCGGCGCAACTCCTTTGATTAGCATACTCAAAGATGTACTAAACAACATTAAGCAACAAGAAGAAGACTTAGA
AGAAGGAGGGGAGGTGGAAAGCGGAGTTAAGAACAATAAGAAAAGGCCTTTTGCAACCAAGCGAGCCTATTTCTATTGGGTTACTCGTGAGCAAGGTTCGTTTGAATGGTTTAAAGGTGT
GATGAATGAGGTAGCGGAGAATGATAAGGAAGGAGTAATTGAGCTTCACAATTATTGTACAAGTGTTTATGAAGAAGGCGACGCTCGTTCGGCTTTGATCACAATGCTTCAGTCCCTTCA
CCATGCCAAAAATGGTGTGGATGTAGTTTCAGAGACAAGGGTTAAGACACATTTTGCTAGGCCAAATTGGCGTAATGTCTATAAACATGTTGCTCTTAAACACCCTGAAAAAAAAGTTG
G
TAAGTATGGATTTATCTCTTAATTAGTTTGGTTGATGAAATTTAAGTTAACATATTTTTTAGCAAATTTATAATATAACATACATTATGTTCTTAGGTGTTTTTTACTGTGGAGCACATG
GATTGGTTGGCGAACTAAGAAAGCTTTCTTTGGACTTTTCAAGAAAAACTGGCACCAAGTTTGATTTTCATAAAGAGAATTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAATTGATCAAGAGAACAAACATGAATCATGGTCGGAGCCAGAGAGCACCGGAAGCCGAAGCTCAGGGGTGGGCCTCAGTGGGCCTTTAGCATCCAAAAAACAACGAAACCGAAGC
AAGAACAAAAGTGCAAGCTTCAAGGACGATGGTGAAATGGTGGAGATAACATTGAACGTACGTGATGACTCCGTTTCCGTTCAGAATATTCGCGGTGGAGACACTGAAACGGCGTTTCTG
GCAAGCCAGCTTGAGAAGCGTCCATCGTCGCTTTCGGCTAAACTGAGACAGGTGTCTCAGGAGCTGAAGCGCATGACGTCTTTTAAGGCGTTTGATAAGGTTGATAGGTCAAAATCTGGT
GCTGCTCGTGCTCTACAAGGTCTTAAGTTTATGACAAAAAACGTTGGAAGTGAAGGTTGGTCCCAAGTTGAGAAGCGTTTTGATGAGTTGGCTGTGGAGGGAAAATTGCCCAAGACTCGA
TTTAGCCAGTGCATAG
GAATGAACGAGTCAAAGGAGTTTGCTGGTGAGTTATTTGATGCCTTAGCACGTCGTCGAGGTATAGTAGCTGCTTCCATAACAAAGGAAGAGTTGCGAGAATTT
TGGGACCAAATTACTGATCAAAGCTTTGATTCAAGGCTTCAGACCTTTTTTGGCAT
GGTGGACAAGAATGCTGATGGACGAATTACTGAAGAAGAAGTAAAAGAGATTATTGCTTTAAGT
GCTTCGGCCAATAAGCTATCAAAGTTACAAGAACGAGCAGAGGAATATGCTGCCCTTATCATGGAGGAGCTAGACCCAAACAACCTTGGATATATTGAG
CTGTATAACTTGGAAATGCTT
CTTTTGCAAGCACCAGCACAATCAGCTCACATAACTACAGATAGTAGGGTATTGAGCCAGATGTTGAGCCAGAAGTTAGTCCCTACTAAAGAGCGCAACCCTATTAAACGGGCTTTTAGA
GAACTAGCTTATTTTATGGAGGATAATTGGAAACGTATTTGGATCATAGCTCTATGGCTTTCAATTTGTGCAGCACTTTTCACTTGGAAGTTCATCCAGTACAAACGTCGTGCCGTTTTC
CATGTCATGGGCTATTGTGTCACCACGGCTAAGGGCGGTGCCGAGACGCTCAAGTTTAACATGGCCTTGATCTTGTTGCCTGTATGTAGAAACACCATCACTTGGCTTAGGAGTAGGACC
AGGCTTGGAATGGTGGTTCCATTTGATGACAATATCAACTTTCACAAG
GTGATAGCTTTTGGCATTGCAATTGGGGTTGGATTACATGCAATTTCACATTTAACTTGTGACTTCCCAAGA
TTATTACACGCCACAGATGAAGAATATGAACCCATGAAACAATTTTTTGGAGATGAAAGACCTAATAATTATTGGTGGTTCGTTAAAGGAACCGAGGGTTGGACCGGTGTGGTCATGGTT
GTGCTTATGGCTATAGCTTTCATTTTAGCACAACCTTGGTTTCGTCGTAATAGGCTAAACCTTCCAAAACCCCTCAAGAAACTCACTGGTTTCAATGCATTTTGGTATTCACATCACCTT
TTTGTCATTGTTTACGTGCTATTTATCATTCATGGATACTTCCTTTACCTTAGCAAGAAATGGTATAAGAAAACG
ACATGGATGTATCTTGCGGTTCCAATGATACTATACGGATGCGAA
AGACTACTTCGTGCATTTAGATCTGGCTACAAATCTGTGAGGATACTAAAG
GTTGCAGTGTACCCGGGAAATGTACTAGCATTGCATGCATCTAAACCACAAGGGTTTAAGTACACTAGT
GGACAGTATATTTATGTTAATTGTTCAGATATCTCCCCATTTGAATG
GCATCCCTTTTCTATTACATCAGCTCCTGGAGATGACTATATAAGTGTTCACATTCGAACTTTGGGCGATTGG
ACGTCACAACTGAAGGGTATTTTCGCCAAG
GCATGTCAACCAGCAAATGATGACCAAAGTGGTCTTCTAAGAGCTGATATGTTACCAGGCAAATCAAGCCTACCAAGGATGCCAAGGCTA
CGAATTGATGGACCTTATGGAGCACCAGCACAAGACTACAAAAACTATGAAGTCCTTCTTCTAGTAGGGCTAGGAATCGGCGCAACTCCTTTGATTAGCATACTCAAAGATGTACTAAAC
AACATTAAGCAACAAGAAGAAGACTTAGAAGAAGGAGGGGAGGTGGAAAGCGGAGTTAAGAACAATAAGAAAAGGCCTTTTGCAACCAAGCGAGCCTATTTCTATTGGGTTACTCGTGAG
CAAGGTTCGTTTGAATGGTTTAAAGGTGTGATGAATGAGGTAGCGGAGAATGATAAGGAAGGAGTAATTGAGCTTCACAATTATTGTACAAGTGTTTATGAAGAAGGCGACGCTCGTTCG
GCTTTGATCACAATGCTTCAGTCCCTTCACCATGCCAAAAATGGTGTGGATGTAGTTTCAGAGACAAGGGTTAAGACACATTTTGCTAGGCCAAATTGGCGTAATGTCTATAAACATGTT
GCTCTTAAACACCCTGAAAAAAAAGTTG
GTGTTTTTTACTGTGGAGCACATGGATTGGTTGGCGAACTAAGAAAGCTTTCTTTGGACTTTTCAAGAAAAACTGGCACCAAGTTTGATTTT
CATAAAGAGAATTTTTAG

Retrieve as FASTA